Transcript: Human XM_011516805.1

PREDICTED: Homo sapiens protein tyrosine phosphatase 4A3 (PTP4A3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTP4A3 (11156)
Length:
2304
CDS:
373..894

Additional Resources:

NCBI RefSeq record:
XM_011516805.1
NBCI Gene record:
PTP4A3 (11156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355596 CAAGACCCGGTGCTGCGTTAT pLKO_005 870 CDS 100% 3.600 5.040 N PTP4A3 n/a
2 TRCN0000010661 ACCGTTGTGGACTGGCCGTTT pLKO.1 562 CDS 100% 1.350 1.890 N PTP4A3 n/a
3 TRCN0000355595 CAAACAGAGGCTGCGGTTCAA pLKO_005 834 CDS 100% 4.950 3.960 N PTP4A3 n/a
4 TRCN0000355597 GTGTGTGAAGTGACCTATGAC pLKO_005 514 CDS 100% 4.950 3.960 N PTP4A3 n/a
5 TRCN0000220145 TCTCGGCACCTTAAATTATTA pLKO.1 1294 3UTR 100% 15.000 10.500 N PTP4A3 n/a
6 TRCN0000368291 AGCTCACCTACCTGGAGAAAT pLKO_005 806 CDS 100% 13.200 9.240 N PTP4A3 n/a
7 TRCN0000220144 CTACAAACACATGCGCTTCCT pLKO.1 411 CDS 100% 2.640 1.848 N PTP4A3 n/a
8 TRCN0000010662 GCGTGTGTGTGAAGTGACCTA pLKO.1 510 CDS 100% 2.640 1.848 N PTP4A3 n/a
9 TRCN0000029871 GCGCTTCCTCATCACCCACAA pLKO.1 423 CDS 100% 1.350 0.945 N Ptp4a3 n/a
10 TRCN0000319972 GCGCTTCCTCATCACCCACAA pLKO_005 423 CDS 100% 1.350 0.945 N Ptp4a3 n/a
11 TRCN0000010660 ACAAACACATGCGCTTCCTCA pLKO.1 413 CDS 100% 2.640 1.584 N PTP4A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02632 pDONR223 100% 85.5% 85.5% None 330_404del n/a
2 ccsbBroad304_02632 pLX_304 0% 85.5% 85.5% V5 330_404del n/a
3 TRCN0000474068 CCAAGAGTACGCCGTGGATCCAGG pLX_317 100% 85.5% 85.5% V5 330_404del n/a
Download CSV