Transcript: Human XM_011516918.1

PREDICTED: Homo sapiens t-SNARE domain containing 1 (TSNARE1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSNARE1 (203062)
Length:
3949
CDS:
40..2325

Additional Resources:

NCBI RefSeq record:
XM_011516918.1
NBCI Gene record:
TSNARE1 (203062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139628 CCAACGTCTTCCGAATCAACT pLKO.1 686 CDS 100% 4.950 3.960 N TSNARE1 n/a
2 TRCN0000139589 CAGGAGACCAACAAGACCATT pLKO.1 796 CDS 100% 4.950 3.465 N TSNARE1 n/a
3 TRCN0000142437 GCTGATGATGAGAAGGTCTTT pLKO.1 1051 CDS 100% 4.950 3.465 N TSNARE1 n/a
4 TRCN0000144891 GAATCAGATCATCAAGGACTT pLKO.1 1200 CDS 100% 4.050 2.835 N TSNARE1 n/a
5 TRCN0000139660 GAAGGTCTTTAACGGGAGTGA pLKO.1 1062 CDS 100% 2.640 1.848 N TSNARE1 n/a
6 TRCN0000140488 GAGAAGGTCTTTAACGGGAGT pLKO.1 1060 CDS 100% 2.160 1.512 N TSNARE1 n/a
7 TRCN0000140016 GAGCAAGGAGAAGCTGTTGAT pLKO.1 1237 CDS 100% 4.950 3.465 N TSNARE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13397 pDONR223 100% 54.2% 51.6% None (many diffs) n/a
2 TRCN0000480078 GAGCTTGGTGTTCGTCCACGAAGA pLX_317 24% 54.2% 51.6% V5 (many diffs) n/a
3 ccsbBroadEn_05205 pDONR223 100% 54.1% 51.5% None (many diffs) n/a
4 ccsbBroad304_05205 pLX_304 0% 54.1% 51.5% V5 (many diffs) n/a
5 TRCN0000465424 AGAGGACCTCTTTCGGCACCTCGG pLX_317 25.7% 54.1% 51.5% V5 (many diffs) n/a
Download CSV