Transcript: Human XM_011517386.2

PREDICTED: Homo sapiens tumor protein p53 inducible nuclear protein 1 (TP53INP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TP53INP1 (94241)
Length:
5466
CDS:
237..959

Additional Resources:

NCBI RefSeq record:
XM_011517386.2
NBCI Gene record:
TP53INP1 (94241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128518 CCTCTTAACAGAAATAGCCTT pLKO.1 843 CDS 100% 2.640 2.112 N TP53INP1 n/a
2 TRCN0000149560 GCGCCATGTTTCTCAAAGTTT pLKO.1 3714 3UTR 100% 5.625 3.938 N TP53INP1 n/a
3 TRCN0000130124 CAAGGTGGAAACAAGTCCTAT pLKO.1 572 CDS 100% 4.950 3.465 N TP53INP1 n/a
4 TRCN0000150087 CATAGATACTTGCACTGGTTT pLKO.1 344 CDS 100% 4.950 3.465 N TP53INP1 n/a
5 TRCN0000130160 CCATGCAAACTGTTCCTGTTT pLKO.1 3975 3UTR 100% 4.950 3.465 N TP53INP1 n/a
6 TRCN0000149881 GCCTTCTATCTTGGATGGTTT pLKO.1 4468 3UTR 100% 4.950 3.465 N TP53INP1 n/a
7 TRCN0000149477 GCTTGGCTGATACAAGTGATT pLKO.1 460 CDS 100% 4.950 3.465 N TP53INP1 n/a
8 TRCN0000150079 CATTGTTATGTTGCAGCTCTT pLKO.1 744 CDS 100% 4.050 2.835 N TP53INP1 n/a
9 TRCN0000150040 CTGATGAATTACATAGCCCAA pLKO.1 679 CDS 100% 2.160 1.512 N TP53INP1 n/a
10 TRCN0000147821 GCCTTCATAATCAAACAGCTT pLKO.1 2502 3UTR 100% 2.640 1.584 N TP53INP1 n/a
11 TRCN0000145134 GAAGAAGAAGAAGAAGAGGAA pLKO.1 372 CDS 100% 2.640 1.320 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04622 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04622 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479500 ATGCTTCCGGATTATGGTACCGTC pLX_317 47.5% 100% 100% V5 n/a
Download CSV