Transcript: Human XM_011517764.2

PREDICTED: Homo sapiens GLIS family zinc finger 3 (GLIS3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLIS3 (169792)
Length:
7160
CDS:
223..3015

Additional Resources:

NCBI RefSeq record:
XM_011517764.2
NBCI Gene record:
GLIS3 (169792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107588 CGGGATAGATTTCAATACCAT pLKO.1 1158 CDS 100% 3.000 4.200 N GLIS3 n/a
2 TRCN0000107589 CCAGCAATTATTCAAGCCGAA pLKO.1 2363 CDS 100% 2.160 3.024 N GLIS3 n/a
3 TRCN0000428587 AGTGACCTGCCTCACCTAATC pLKO_005 3416 3UTR 100% 10.800 8.640 N GLIS3 n/a
4 TRCN0000427784 AGATACCAGGTCCCTTATTTC pLKO_005 810 CDS 100% 13.200 9.240 N GLIS3 n/a
5 TRCN0000107586 CGGGCATTACAGTGTATGATT pLKO.1 2867 CDS 100% 5.625 3.938 N GLIS3 n/a
6 TRCN0000107585 GCAGAGTTACTGATGTTCTTT pLKO.1 3129 3UTR 100% 5.625 3.938 N GLIS3 n/a
7 TRCN0000107587 GCCAGAAACAAACTCTTCTTT pLKO.1 2649 CDS 100% 5.625 3.938 N GLIS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09779 pDONR223 100% 83.1% 82.9% None (many diffs) n/a
2 ccsbBroad304_09779 pLX_304 0% 83.1% 82.9% V5 (many diffs) n/a
3 TRCN0000468663 TTCTCTACAAAACGCCGTTGCAGT pLX_317 18.9% 83.1% 82.9% V5 (many diffs) n/a
Download CSV