Transcript: Human XM_011520098.2

PREDICTED: Homo sapiens LIM domain only 1 (LMO1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMO1 (4004)
Length:
834
CDS:
85..522

Additional Resources:

NCBI RefSeq record:
XM_011520098.2
NBCI Gene record:
LMO1 (4004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232092 CGCTCTCCTGCCACATTAGAA pLKO_005 621 3UTR 100% 5.625 7.875 N LMO1 n/a
2 TRCN0000015047 CAGCTCTGCAACCAGAGATTT pLKO.1 400 CDS 100% 1.320 1.848 N LMO1 n/a
3 TRCN0000015043 GCCACATTAGAACTTCTCCGT pLKO.1 630 3UTR 100% 0.660 0.924 N LMO1 n/a
4 TRCN0000015045 CGCGACTACCTGAGGCTCTTT pLKO.1 277 CDS 100% 1.650 1.320 N LMO1 n/a
5 TRCN0000232090 ATGAGGAAGGGCAGCTCAATG pLKO_005 476 CDS 100% 10.800 7.560 N LMO1 n/a
6 TRCN0000015046 CAGCTCAATGGCACCTTTGAA pLKO.1 487 CDS 100% 5.625 3.938 N LMO1 n/a
7 TRCN0000015044 CAACATGATCTTGTGTCAGAT pLKO.1 450 CDS 100% 4.950 3.465 N LMO1 n/a
8 TRCN0000232089 CAACATGATCTTGTGTCAGAT pLKO_005 450 CDS 100% 4.950 3.465 N LMO1 n/a
9 TRCN0000232091 CACCTTTGAATCCCAAGTTCA pLKO_005 498 CDS 100% 4.950 3.465 N LMO1 n/a
10 TRCN0000232088 GCTGAAGGCATTGGACAAGTA pLKO_005 159 CDS 100% 4.950 3.465 N LMO1 n/a
11 TRCN0000054567 CCTGAAGAACAACATGATCTT pLKO.1 441 CDS 100% 4.950 2.970 N Lmo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06530 pDONR223 100% 92.9% 92.9% None 0_1ins33 n/a
2 ccsbBroad304_06530 pLX_304 0% 92.9% 92.9% V5 0_1ins33 n/a
3 TRCN0000473676 TTTATAGTACTATCGAGGGAACTC pLX_317 98.7% 92.9% 92.9% V5 0_1ins33 n/a
4 ccsbBroadEn_03676 pDONR223 100% 80% 89.6% None (many diffs) n/a
5 ccsbBroad304_03676 pLX_304 0% 80% 89.6% V5 (many diffs) n/a
6 TRCN0000467106 AGCGATGATACCCTAACGCCTAGG pLX_317 70.9% 80% 89.6% V5 (many diffs) n/a
Download CSV