Transcript: Human XM_011520402.1

PREDICTED: Homo sapiens gamma-butyrobetaine hydroxylase 1 (BBOX1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BBOX1 (8424)
Length:
2165
CDS:
777..1940

Additional Resources:

NCBI RefSeq record:
XM_011520402.1
NBCI Gene record:
BBOX1 (8424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424016 TTGTGAGATATGGCACATTAT pLKO_005 1984 3UTR 100% 13.200 18.480 N BBOX1 n/a
2 TRCN0000432895 TGTCAAGGCTTCGTATCTTAA pLKO_005 1894 CDS 100% 13.200 10.560 N BBOX1 n/a
3 TRCN0000418721 GATGTGAACATTGGAATTAAA pLKO_005 951 CDS 100% 15.000 10.500 N BBOX1 n/a
4 TRCN0000064709 CCTCTACCTTTGTGGACTTTA pLKO.1 1534 CDS 100% 13.200 9.240 N BBOX1 n/a
5 TRCN0000413474 TAAGCTTTCACACTGATTATC pLKO_005 1372 CDS 100% 13.200 9.240 N BBOX1 n/a
6 TRCN0000064711 GCTGCTCTGAAGGAGTTTGTT pLKO.1 1710 CDS 100% 5.625 3.938 N BBOX1 n/a
7 TRCN0000064710 CCCGATGAGCATTACAGTGAA pLKO.1 1011 CDS 100% 4.950 3.465 N BBOX1 n/a
8 TRCN0000064708 GCACGGAAACTTCTAGTGGAA pLKO.1 924 CDS 100% 2.640 1.848 N BBOX1 n/a
9 TRCN0000064712 GATGGGTTTAATGTGTGCCAA pLKO.1 1473 CDS 100% 2.640 1.584 N BBOX1 n/a
10 TRCN0000096887 GCTCCCTTTAAAGAGGCTCTT pLKO.1 92 5UTR 100% 4.050 2.430 N Gnl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07237 pDONR223 100% 99.8% 100% None 408C>T;906G>A n/a
2 ccsbBroad304_07237 pLX_304 0% 99.8% 100% V5 408C>T;906G>A n/a
3 TRCN0000467300 ATTTACCCCAGACATTCGTTGTGC pLX_317 36.8% 99.8% 100% V5 408C>T;906G>A n/a
Download CSV