Transcript: Human XM_011521559.3

PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMAD3 (4088)
Length:
5847
CDS:
43..1188

Additional Resources:

NCBI RefSeq record:
XM_011521559.3
NBCI Gene record:
SMAD3 (4088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020009 CTGTGTGAGTTCGCCTTCAAT pLKO.1 364 CDS 100% 5.625 7.875 N SMAD3 n/a
2 TRCN0000020013 GAGCCTGGTCAAGAAACTCAA pLKO.1 150 CDS 100% 4.950 6.930 N SMAD3 n/a
3 TRCN0000330127 GAGCCTGGTCAAGAAACTCAA pLKO_005 150 CDS 100% 4.950 6.930 N SMAD3 n/a
4 TRCN0000330055 GCCTCAGTGACAGCGCTATTT pLKO_005 830 CDS 100% 13.200 9.240 N SMAD3 n/a
5 TRCN0000330128 TGAGCAGAACAGGTAGTATTA pLKO_005 1451 3UTR 100% 13.200 9.240 N SMAD3 n/a
6 TRCN0000330056 GGATTGAGCTGCACCTGAATG pLKO_005 1094 CDS 100% 10.800 7.560 N SMAD3 n/a
7 TRCN0000353587 TCCGCATGAGCTTCGTCAAAG pLKO_005 1025 CDS 100% 10.800 7.560 N SMAD3 n/a
8 TRCN0000020010 CCGCTGTTCCAGTGTGTCTTA pLKO.1 1167 CDS 100% 4.950 3.465 N SMAD3 n/a
9 TRCN0000020012 CATCTCCTACTACGAGCTGAA pLKO.1 612 CDS 100% 4.050 2.835 N SMAD3 n/a
10 TRCN0000020011 CCCAGCACATAATAACTTGGA pLKO.1 549 CDS 100% 2.640 1.848 N SMAD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06549 pDONR223 100% 89.5% 89.6% None 309A>G;396_397ins132 n/a
2 ccsbBroad304_06549 pLX_304 52.9% 89.5% 89.6% V5 309A>G;396_397ins132 n/a
3 TRCN0000469603 CAAACTTGGTTGGCATGCAAAGAT pLX_317 28.1% 89.5% 89.6% V5 309A>G;396_397ins132 n/a
4 ccsbBroadEn_00961 pDONR223 100% 62% 75.3% None (many diffs) n/a
5 ccsbBroad304_00961 pLX_304 0% 62% 75.3% V5 (many diffs) n/a
6 TRCN0000465710 TTTCGGTCGAACATAGACGACCGG pLX_317 25.6% 62% 75.3% V5 (many diffs) n/a
Download CSV