Transcript: Human XM_011521590.2

PREDICTED: Homo sapiens myocyte enhancer factor 2A (MEF2A), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEF2A (4205)
Length:
2422
CDS:
367..1290

Additional Resources:

NCBI RefSeq record:
XM_011521590.2
NBCI Gene record:
MEF2A (4205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005136 GCTAGCACTGATATGGACAAA pLKO.1 538 CDS 100% 4.950 6.930 N MEF2A n/a
2 TRCN0000005133 CCAGACCCTGATACTTCATAT pLKO.1 661 CDS 100% 13.200 10.560 N MEF2A n/a
3 TRCN0000427703 AGCAGAACCAACTCGGATATT pLKO_005 598 CDS 100% 13.200 9.240 N MEF2A n/a
4 TRCN0000415441 CTCTAACAAACTGTTTCAATA pLKO_005 516 CDS 100% 13.200 9.240 N MEF2A n/a
5 TRCN0000422926 GTGAAATAGCACTCATCATTT pLKO_005 488 CDS 100% 13.200 9.240 N MEF2A n/a
6 TRCN0000005134 GCTTAGGCAAAGTCATGCCTA pLKO.1 1115 CDS 100% 0.264 0.185 N MEF2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06575 pDONR223 100% 58.8% 57.8% None (many diffs) n/a
2 ccsbBroad304_06575 pLX_304 0% 58.8% 57.8% V5 (many diffs) n/a
3 TRCN0000472816 CTCACACGAGAGGTCGTGTTGCCG pLX_317 9.8% 58.8% 57.8% V5 (many diffs) n/a
4 ccsbBroadEn_10962 pDONR223 100% 40.9% 34.7% None (many diffs) n/a
5 ccsbBroad304_10962 pLX_304 0% 40.9% 34.7% V5 (many diffs) n/a
6 TRCN0000479180 TCCACGCGCTGTGCATCGGTCAAG pLX_317 29.8% 40.9% 34.7% V5 (many diffs) n/a
Download CSV