Transcript: Human XM_011522041.1

PREDICTED: Homo sapiens pseudopodium enriched atypical kinase 1 (PEAK1), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PEAK1 (79834)
Length:
4344
CDS:
937..4077

Additional Resources:

NCBI RefSeq record:
XM_011522041.1
NBCI Gene record:
PEAK1 (79834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088549 CCCTGTTAAGTCACCTAATTT pLKO.1 2685 CDS 100% 15.000 21.000 N Peak1 n/a
2 TRCN0000195001 CCCTGTTAAGTCACCTAATTT pLKO.1 2685 CDS 100% 15.000 21.000 N PEAK1 n/a
3 TRCN0000037443 CCACAAGTGTAATAAGCCATA pLKO.1 2906 CDS 100% 4.050 5.670 N PEAK1 n/a
4 TRCN0000333784 CCACAAGTGTAATAAGCCATA pLKO_005 2906 CDS 100% 4.050 5.670 N PEAK1 n/a
5 TRCN0000195688 CCTAAGCGCTGGATATCATTT pLKO.1 3700 CDS 100% 13.200 9.240 N PEAK1 n/a
6 TRCN0000199724 GCCATGTTCCTAAGCCTTATG pLKO.1 1316 CDS 100% 10.800 7.560 N PEAK1 n/a
7 TRCN0000037442 CCTCTAGTAATAATCAGGATA pLKO.1 2105 CDS 100% 4.950 3.465 N PEAK1 n/a
8 TRCN0000037440 CCCACTATGATAGTGGCAGAT pLKO.1 1159 CDS 100% 0.405 0.284 N PEAK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15152 pDONR223 17.6% 51.6% 10.3% None (many diffs) n/a
2 ccsbBroad304_15152 pLX_304 0% 51.6% 10.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491580 AATTGGATTGTCGATGTGTTGATT pLX_317 5.1% 51.6% 10.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV