Transcript: Human XM_011523225.3

PREDICTED: Homo sapiens VAC14 component of PIKFYVE complex (VAC14), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VAC14 (55697)
Length:
3150
CDS:
258..2042

Additional Resources:

NCBI RefSeq record:
XM_011523225.3
NBCI Gene record:
VAC14 (55697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153770 CTCAATGACAAGCTGTACGAA pLKO.1 309 CDS 100% 3.000 4.200 N VAC14 n/a
2 TRCN0000343619 TTGTTGCGAGAGAGGATTTAC pLKO_005 792 CDS 100% 13.200 9.240 N VAC14 n/a
3 TRCN0000352951 CCATCCTACTGCAGACGTTAT pLKO_005 1591 CDS 100% 10.800 7.560 N VAC14 n/a
4 TRCN0000343678 TCCAGATCCTGGGTGACAATG pLKO_005 922 CDS 100% 10.800 7.560 N VAC14 n/a
5 TRCN0000153900 CAGTGTGAAGTTTGCTGAGAT pLKO.1 1013 CDS 100% 4.950 3.465 N VAC14 n/a
6 TRCN0000154006 CGTGCAAATCAAGCATGTGAT pLKO.1 395 CDS 100% 4.950 3.465 N VAC14 n/a
7 TRCN0000343676 CGTGCAAATCAAGCATGTGAT pLKO_005 395 CDS 100% 4.950 3.465 N VAC14 n/a
8 TRCN0000155198 GCTTCAATGATGCAGACAGCA pLKO.1 559 CDS 100% 2.640 1.848 N VAC14 n/a
9 TRCN0000173710 CCAGACATTAACCTGCTGGAT pLKO.1 873 CDS 100% 2.640 1.584 N Vac14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03632 pDONR223 100% 74.5% 70.9% None (many diffs) n/a
2 ccsbBroad304_03632 pLX_304 0% 74.5% 70.9% V5 (many diffs) n/a
3 TRCN0000469365 CACACTCTTAGACTCCCATACTGT pLX_317 16.6% 74.5% 70.9% V5 (many diffs) n/a
4 ccsbBroadEn_12254 pDONR223 100% 41.6% 38.4% None (many diffs) n/a
5 ccsbBroad304_12254 pLX_304 0% 41.6% 38.4% V5 (many diffs) n/a
Download CSV