Transcript: Human XM_011523227.3

PREDICTED: Homo sapiens VPS35 retromer complex component (VPS35), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS35 (55737)
Length:
3508
CDS:
916..3219

Additional Resources:

NCBI RefSeq record:
XM_011523227.3
NBCI Gene record:
VPS35 (55737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154947 GCAGATCTCTACGAACTTGTA pLKO.1 1102 CDS 100% 4.950 6.930 N VPS35 n/a
2 TRCN0000337085 GCAGATCTCTACGAACTTGTA pLKO_005 1102 CDS 100% 4.950 6.930 N VPS35 n/a
3 TRCN0000379538 GGGTCTGTTTCTTCGAAATTA pLKO_005 1263 CDS 100% 15.000 12.000 N VPS35 n/a
4 TRCN0000380320 ATGTGAAGAACATAATCATTG pLKO_005 1709 CDS 100% 10.800 8.640 N VPS35 n/a
5 TRCN0000382145 TATCACCAAAGAGTTACTATG pLKO_005 1001 CDS 100% 10.800 8.640 N VPS35 n/a
6 TRCN0000380956 TGGAATCCCAGCGGATATTAA pLKO_005 1776 CDS 100% 15.000 10.500 N VPS35 n/a
7 TRCN0000337019 ACTCACCTTCAGGACCTTAAT pLKO_005 3371 3UTR 100% 13.200 9.240 N VPS35 n/a
8 TRCN0000380211 ACCCACTCTTTGAGTACTTTG pLKO_005 2093 CDS 100% 10.800 7.560 N VPS35 n/a
9 TRCN0000155350 CCAGACTATCAGTGCTTTGAT pLKO.1 2523 CDS 100% 5.625 3.938 N VPS35 n/a
10 TRCN0000155735 CCAGGTGGATTCCATAATGAA pLKO.1 2193 CDS 100% 5.625 3.938 N VPS35 n/a
11 TRCN0000155666 CCTCCAGACTTTGAATCCTTT pLKO.1 1653 CDS 100% 4.950 3.465 N VPS35 n/a
12 TRCN0000337086 CCTCCAGACTTTGAATCCTTT pLKO_005 1653 CDS 100% 4.950 3.465 N VPS35 n/a
13 TRCN0000151306 GATGAAATCAGCGATTCCAAA pLKO.1 2674 CDS 100% 4.950 3.465 N VPS35 n/a
14 TRCN0000155766 CAGTGAAGAAACAGAGCAGAT pLKO.1 3105 CDS 100% 4.050 2.835 N VPS35 n/a
15 TRCN0000337087 CAGTGAAGAAACAGAGCAGAT pLKO_005 3105 CDS 100% 4.050 2.835 N VPS35 n/a
16 TRCN0000152247 CAGATGAGTTTGCTAAAGGAA pLKO.1 1073 CDS 100% 3.000 2.100 N VPS35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03643 pDONR223 100% 96.3% 96.3% None 0_1ins87;1851C>T n/a
2 ccsbBroad304_03643 pLX_304 0% 96.3% 96.3% V5 0_1ins87;1851C>T n/a
3 TRCN0000492290 TTATCTTGTACCTTCATGGTCTAT pLX_317 17% 96.3% 96.3% V5 0_1ins87;1851C>T n/a
Download CSV