Transcript: Human XM_011524286.2

PREDICTED: Homo sapiens musashi RNA binding protein 2 (MSI2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSI2 (124540)
Length:
6265
CDS:
367..1095

Additional Resources:

NCBI RefSeq record:
XM_011524286.2
NBCI Gene record:
MSI2 (124540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423713 CTTCGGATCGAGGGTTGACTA pLKO_005 1247 3UTR 100% 4.950 6.930 N MSI2 n/a
2 TRCN0000432136 TTACACCATGGACGCGTTCAT pLKO_005 666 CDS 100% 4.950 6.930 N MSI2 n/a
3 TRCN0000062812 AGATAGCCTTAGAGACTATTT pLKO.1 113 5UTR 100% 13.200 9.240 N MSI2 n/a
4 TRCN0000062809 GTGGAAGATGTAAAGCAATAT pLKO.1 421 CDS 100% 13.200 9.240 N MSI2 n/a
5 TRCN0000417428 TGCAATGCTGATGTTTGATAA pLKO_005 468 CDS 100% 13.200 9.240 N MSI2 n/a
6 TRCN0000426366 CTTTGATTGCAACGGCCTTTA pLKO_005 1058 CDS 100% 10.800 7.560 N MSI2 n/a
7 TRCN0000062808 CCAGCAAGTGTAGATAAAGTA pLKO.1 225 5UTR 100% 5.625 3.938 N MSI2 n/a
8 TRCN0000071977 CCACCATGAGTTAGATTCCAA pLKO.1 257 5UTR 100% 3.000 2.100 N Msi2 n/a
9 TRCN0000324687 CCACCATGAGTTAGATTCCAA pLKO_005 257 5UTR 100% 3.000 2.100 N Msi2 n/a
10 TRCN0000062811 CCCAACTTCGTGGCGACCTAT pLKO.1 712 CDS 100% 1.650 1.155 N MSI2 n/a
11 TRCN0000071976 GCTACAGTGCTCAACCGAATT pLKO.1 854 CDS 100% 0.000 0.000 N Msi2 n/a
12 TRCN0000353948 GCTACAGTGCTCAACCGAATT pLKO_005 854 CDS 100% 0.000 0.000 N Msi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09483 pDONR223 100% 64.6% 64.7% None 0_1ins312;9A>G;476_529del n/a
2 ccsbBroad304_09483 pLX_304 0% 64.6% 64.7% V5 0_1ins312;9A>G;476_529del n/a
3 TRCN0000465338 GATCTCGCCGAGCCAAACTTGCCT pLX_317 29.5% 64.6% 64.7% V5 0_1ins312;9A>G;476_529del n/a
4 ccsbBroadEn_13107 pDONR223 100% 60.7% 58.2% None (many diffs) n/a
5 ccsbBroad304_13107 pLX_304 0% 60.7% 58.2% V5 (many diffs) n/a
6 TRCN0000468295 CTGACGCTGTAATCCCGACCACGA pLX_317 77.8% 60.7% 58.2% V5 (many diffs) n/a
Download CSV