Transcript: Human XM_011525379.3

PREDICTED: Homo sapiens ubiquitin specific peptidase 32 (USP32), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP32 (84669)
Length:
6380
CDS:
373..4356

Additional Resources:

NCBI RefSeq record:
XM_011525379.3
NBCI Gene record:
USP32 (84669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011129 GACGACAGTATGGGCTATCAA pLKO.1 2977 CDS 100% 5.625 7.875 N USP32 n/a
2 TRCN0000011131 CCACCTATTCGTCCATCTCTA pLKO.1 175 5UTR 100% 4.950 6.930 N USP32 n/a
3 TRCN0000011130 GTGGCTATACAACAGTGAGAA pLKO.1 1545 CDS 100% 4.950 3.960 N USP32 n/a
4 TRCN0000436409 ATCCCAGAGCTGGAATTATTT pLKO_005 1273 CDS 100% 15.000 10.500 N USP32 n/a
5 TRCN0000413822 AGAGAAGATACTCGTATTAAG pLKO_005 4042 CDS 100% 13.200 9.240 N USP32 n/a
6 TRCN0000424722 TGTAAATGGTCGGTGGATAAA pLKO_005 3402 CDS 100% 13.200 9.240 N USP32 n/a
7 TRCN0000431695 GCTCTCCGATAGAGAACTTTC pLKO_005 4553 3UTR 100% 10.800 7.560 N USP32 n/a
8 TRCN0000416779 CCCAGGATTGTGACGACAGTA pLKO_005 2966 CDS 100% 4.950 3.465 N USP32 n/a
9 TRCN0000011128 CGTGAATACTACAGAAGAGAA pLKO.1 858 CDS 100% 4.950 3.465 N USP32 n/a
10 TRCN0000011127 GCACTGATGATATTCCTGAAT pLKO.1 410 CDS 100% 4.950 3.465 N USP32 n/a
11 TRCN0000428840 AGTAGTAAAGAGAACTTGGAT pLKO_005 3805 CDS 100% 3.000 2.100 N USP32 n/a
12 TRCN0000414621 CCCATCCTGATTATTCACCTT pLKO_005 3367 CDS 100% 2.640 1.584 N USP32 n/a
13 TRCN0000011157 CCCAGACATTAGGAGTTCATA pLKO.1 5414 3UTR 100% 5.625 2.813 Y USP32P2 n/a
14 TRCN0000007335 CCCTGCAAGTTGATTCTCATT pLKO.1 5716 3UTR 100% 4.950 2.475 Y USP6 n/a
15 TRCN0000011159 GCACAATTTCTGCCAAAGATT pLKO.1 4255 CDS 100% 5.625 2.813 Y USP32P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492225 TATACGCCTCCTCACCATAAATTC pLX_317 8% 81.1% 81.1% V5 (not translated due to prior stop codon) 0_1ins873;994_1035del;2211C>T n/a
2 TRCN0000488115 GTCATCACGCGGCCGTTATCCCAT pLX_317 7.3% 81.1% 81% V5 (many diffs) n/a
3 ccsbBroadEn_13327 pDONR223 100% 5% 4.4% None (many diffs) n/a
4 ccsbBroad304_13327 pLX_304 0% 5% 4.4% V5 (many diffs) n/a
5 TRCN0000476448 GTATAATACAGCTCGGATCTAGCC pLX_317 100% 5% 4.4% V5 (many diffs) n/a
Download CSV