Transcript: Human XM_011525441.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 14 (MAP3K14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K14 (9020)
Length:
4606
CDS:
263..3106

Additional Resources:

NCBI RefSeq record:
XM_011525441.2
NBCI Gene record:
MAP3K14 (9020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230429 TCAGGACTCACGTAGCATTAA pLKO_005 4340 3UTR 100% 13.200 18.480 N MAP3K14 n/a
2 TRCN0000010542 CTCAGGACTCACGTAGCATTA pLKO.1 4339 3UTR 100% 10.800 15.120 N MAP3K14 n/a
3 TRCN0000230427 CTCGATCAGAACTCCACAAAC pLKO_005 927 CDS 100% 10.800 15.120 N MAP3K14 n/a
4 TRCN0000230426 AGATCCTGAATGACGTGATTA pLKO_005 429 CDS 100% 13.200 9.240 N MAP3K14 n/a
5 TRCN0000218404 ATGGTGTGAAAGTCCAAATAC pLKO_005 2838 CDS 100% 13.200 9.240 N MAP3K14 n/a
6 TRCN0000230428 CAAGACATCCACCGCCAAATC pLKO_005 2277 CDS 100% 10.800 7.560 N MAP3K14 n/a
7 TRCN0000199183 CCAGGCTGAGTGTGAGAATAG pLKO.1 508 CDS 100% 10.800 7.560 N MAP3K14 n/a
8 TRCN0000355525 CCCATCAAAGGCCTCTCAAAG pLKO_005 2698 CDS 100% 10.800 7.560 N MAP3K14 n/a
9 TRCN0000355573 CGCTTGGATCAGTGACCATTT pLKO_005 3414 3UTR 100% 10.800 7.560 N MAP3K14 n/a
10 TRCN0000000731 CCCAGAATTGTCCCTTTGTAT pLKO.1 1610 CDS 100% 5.625 3.938 N MAP3K14 n/a
11 TRCN0000000732 CCTCGATCAGAACTCCACAAA pLKO.1 926 CDS 100% 4.950 3.465 N MAP3K14 n/a
12 TRCN0000000734 GTGTGAGAATAGCCAAGAGTT pLKO.1 517 CDS 100% 4.950 3.465 N MAP3K14 n/a
13 TRCN0000000733 GCTGTGTGTCTTCAACCTGAT pLKO.1 1874 CDS 100% 4.050 2.835 N MAP3K14 n/a
14 TRCN0000196415 GCTATTTCAATGGTGTGAAAG pLKO.1 2829 CDS 100% 1.080 0.756 N MAP3K14 n/a
15 TRCN0000355574 GCAGCTGGAAATAGAATTATT pLKO_005 2575 CDS 100% 15.000 9.000 N MAP3K14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14922 pDONR223 0% 99.9% 100% None 2706C>G n/a
2 ccsbBroad304_14922 pLX_304 .8% 99.9% 100% V5 2706C>G n/a
3 TRCN0000479996 TTTAAGCGACAAGCGATCCGCGCG pLX_317 13.3% 99.9% 100% V5 2706C>G n/a
4 TRCN0000488609 GACCGGGAGATCTAGTCATGTGTG pLX_317 11.9% 99.9% 100% V5 (not translated due to prior stop codon) 2706C>G n/a
5 ccsbBroadEn_14009 pDONR223 100% 99.9% 1.5% None 10delA;2706C>G n/a
6 TRCN0000469985 TACGTTGGCCACCGGCCATATTTC pLX_317 .4% 99.9% 1.5% V5 (not translated due to prior stop codon) 10delA;2706C>G n/a
Download CSV