Transcript: Human XM_011526256.1

PREDICTED: Homo sapiens proline-serine-threonine phosphatase interacting protein 2 (PSTPIP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSTPIP2 (9050)
Length:
2900
CDS:
129..977

Additional Resources:

NCBI RefSeq record:
XM_011526256.1
NBCI Gene record:
PSTPIP2 (9050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003019 GCCTCAGTGGTGCAAGATTTA pLKO.1 1393 3UTR 100% 13.200 18.480 N PSTPIP2 n/a
2 TRCN0000297734 GCCTCAGTGGTGCAAGATTTA pLKO_005 1393 3UTR 100% 13.200 18.480 N PSTPIP2 n/a
3 TRCN0000003020 GTGAACCCGAAGCAACAAGAA pLKO.1 465 CDS 100% 4.950 6.930 N PSTPIP2 n/a
4 TRCN0000297331 GTGAACCCGAAGCAACAAGAA pLKO_005 465 CDS 100% 4.950 6.930 N PSTPIP2 n/a
5 TRCN0000003021 GAAGAGAGGTATGGCAAAGAT pLKO.1 13 5UTR 100% 5.625 3.938 N PSTPIP2 n/a
6 TRCN0000297266 GAAGAGAGGTATGGCAAAGAT pLKO_005 13 5UTR 100% 5.625 3.938 N PSTPIP2 n/a
7 TRCN0000003023 CTTTGGTTGATGACTACAGTT pLKO.1 943 CDS 100% 4.950 3.465 N PSTPIP2 n/a
8 TRCN0000003022 CACATTCAGCTTGCACAGAGT pLKO.1 243 CDS 100% 2.640 1.848 N PSTPIP2 n/a
9 TRCN0000342392 CACATTCAGCTTGCACAGAGT pLKO_005 243 CDS 100% 2.640 1.848 N PSTPIP2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2529 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2529 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14010 pDONR223 100% 69.2% 49.6% None (many diffs) n/a
2 ccsbBroad304_14010 pLX_304 0% 69.2% 49.6% V5 (many diffs) n/a
3 TRCN0000465958 AAGCTGAGTCGGGCCAGGGGTGCC pLX_317 40.6% 69.2% 49.6% V5 (many diffs) n/a
Download CSV