Transcript: Human XM_011526391.1

PREDICTED: Homo sapiens leukocyte immunoglobulin like receptor A2 (LILRA2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LILRA2 (11027)
Length:
1524
CDS:
621..1424

Additional Resources:

NCBI RefSeq record:
XM_011526391.1
NBCI Gene record:
LILRA2 (11027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056843 GCTGAGGAGTACCATCTATAT pLKO.1 783 CDS 100% 13.200 18.480 N LILRA2 n/a
2 TRCN0000056844 CCACAATCACTCATCAGAGTA pLKO.1 923 CDS 100% 4.950 6.930 N LILRA2 n/a
3 TRCN0000438058 CCTGGGTTAGACGGATACAAG pLKO_005 823 CDS 100% 4.950 6.930 N LILRA2 n/a
4 TRCN0000056845 GCGGTATCACTGTCAGTACTA pLKO.1 899 CDS 100% 4.950 6.930 N LILRA2 n/a
5 TRCN0000438402 CAGATGCTACAGCTCACTCAG pLKO_005 1467 3UTR 100% 4.050 2.835 N LILRA2 n/a
6 TRCN0000056876 CCACACTTTCCTTCTGACCAA pLKO.1 1338 CDS 100% 2.640 1.320 Y LILRA1 n/a
7 TRCN0000056874 GAGAAGATGAACACCCACAAT pLKO.1 1093 CDS 100% 4.950 2.475 Y LILRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07730 pDONR223 100% 57.2% 45.1% None 404C>T;652_653ins332;801_802ins265 n/a
2 ccsbBroad304_07730 pLX_304 0% 57.2% 45.1% V5 404C>T;652_653ins332;801_802ins265 n/a
3 ccsbBroadEn_07729 pDONR223 100% 54.8% 41.1% None (many diffs) n/a
4 ccsbBroad304_07729 pLX_304 0% 54.8% 41.1% V5 (many diffs) n/a
5 TRCN0000478306 AGCCAAGCTCAGGCTTTGGACACT pLX_317 25.7% 54.8% 41.1% V5 (many diffs) n/a
6 ccsbBroadEn_02599 pDONR223 100% 48.7% 35.8% None (many diffs) n/a
7 ccsbBroad304_02599 pLX_304 0% 48.7% 35.8% V5 (many diffs) n/a
8 TRCN0000476912 AATATTGCGCGCAACCGAGCATCT pLX_317 19.2% 48.7% 35.8% V5 (many diffs) n/a
9 ccsbBroadEn_07695 pDONR223 100% 36.8% 31.1% None (many diffs) n/a
10 ccsbBroad304_07695 pLX_304 0% 36.8% 31.1% V5 (many diffs) n/a
11 TRCN0000477615 ACCTCCGGAGCACCCTCCTCATAA pLX_317 20.9% 36.8% 31.1% V5 (many diffs) n/a
Download CSV