Transcript: Human XM_011527134.1

PREDICTED: Homo sapiens sphingosine kinase 2 (SPHK2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPHK2 (56848)
Length:
2657
CDS:
167..2023

Additional Resources:

NCBI RefSeq record:
XM_011527134.1
NBCI Gene record:
SPHK2 (56848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359275 CAGGATTGCGCTCGCTTTCAT pLKO_005 2142 3UTR 100% 5.625 7.875 N SPHK2 n/a
2 TRCN0000359274 GAGGGTAGTGCCTGATCAATG pLKO_005 2225 3UTR 100% 10.800 8.640 N SPHK2 n/a
3 TRCN0000036969 GCTTCGTGTCAGATGTGGATA pLKO.1 1071 CDS 100% 4.950 3.960 N SPHK2 n/a
4 TRCN0000359273 CTTCGTGTCAGATGTGGATAT pLKO_005 1072 CDS 100% 10.800 7.560 N SPHK2 n/a
5 TRCN0000359272 GGTTGCTTCTATTGGTCAATC pLKO_005 603 CDS 100% 10.800 7.560 N SPHK2 n/a
6 TRCN0000195359 CATCCAGACAGAACGACAGAA pLKO.1 709 CDS 100% 4.950 3.465 N SPHK2 n/a
7 TRCN0000036970 GTTGCTCAACTGCTCACTGTT pLKO.1 958 CDS 100% 4.950 3.465 N SPHK2 n/a
8 TRCN0000036971 CTTCTATTGGTCAATCCCTTT pLKO.1 608 CDS 100% 4.050 2.835 N SPHK2 n/a
9 TRCN0000036973 CTACTTCTGCATCTACACCTA pLKO.1 397 CDS 100% 2.640 1.848 N SPHK2 n/a
10 TRCN0000036972 CTTTGTGCTCATGTTGGCCAT pLKO.1 1669 CDS 100% 2.160 1.512 N SPHK2 n/a
11 TRCN0000199038 CCAAGGCAGCTCTACACTCAC pLKO.1 1491 CDS 100% 1.350 0.945 N SPHK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15113 pDONR223 0% 94.4% 94.4% None 0_1ins108 n/a
2 ccsbBroad304_15113 pLX_304 0% 94.4% 94.4% V5 0_1ins108 n/a
3 TRCN0000468571 ACGACCGTCCCTTAAAGTGCGCCC pLX_317 16.5% 94.4% 94.4% V5 0_1ins108 n/a
4 TRCN0000487788 GCGCACTGCGGATGATCGCCATGT pLX_317 11.5% 94.4% 94.4% V5 (not translated due to prior stop codon) 0_1ins108 n/a
Download CSV