Transcript: Human XM_011527190.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type H (PTPRH), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRH (5794)
Length:
2636
CDS:
74..2407

Additional Resources:

NCBI RefSeq record:
XM_011527190.1
NBCI Gene record:
PTPRH (5794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355581 AGACTTGAACCCGGGTGTTTG pLKO_005 1157 CDS 100% 10.800 15.120 N PTPRH n/a
2 TRCN0000355580 CCAATGAGACGTGGTACAAAG pLKO_005 1968 CDS 100% 10.800 15.120 N PTPRH n/a
3 TRCN0000355578 CCACTCTCAGTTGTACGTATA pLKO_005 1867 CDS 100% 10.800 15.120 N PTPRH n/a
4 TRCN0000002868 GAGACCCGAAACACAACAAAT pLKO.1 1385 CDS 100% 13.200 10.560 N PTPRH n/a
5 TRCN0000355579 GGTGGAGAAAGACGGAGTAAA pLKO_005 394 CDS 100% 13.200 9.240 N PTPRH n/a
6 TRCN0000002867 GCGGCACAACAGAGACTCGAA pLKO.1 306 CDS 100% 0.880 0.616 N PTPRH n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2520 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2521 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06818 pDONR223 100% 67.9% 67.2% None (many diffs) n/a
2 ccsbBroad304_06818 pLX_304 0% 67.9% 67.2% V5 (many diffs) n/a
3 TRCN0000481234 GATTGGGCTGAAGACGTCTATATC pLX_317 13.6% 67.9% 67.2% V5 (many diffs) n/a
Download CSV