Transcript: Human XM_011528507.1

PREDICTED: Homo sapiens death inducer-obliterator 1 (DIDO1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIDO1 (11083)
Length:
8545
CDS:
225..7055

Additional Resources:

NCBI RefSeq record:
XM_011528507.1
NBCI Gene record:
DIDO1 (11083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262646 TCGCCGTCACTGTTGTATAAA pLKO_005 1899 CDS 100% 15.000 21.000 N DIDO1 n/a
2 TRCN0000262645 CCAACGCCCTGTATTGCATTT pLKO_005 1021 CDS 100% 10.800 15.120 N DIDO1 n/a
3 TRCN0000015093 GCGAGCGATCACAATTACAAT pLKO.1 1848 CDS 100% 5.625 7.875 N DIDO1 n/a
4 TRCN0000282358 CGGTGCTCAGGCAGGTATTAA pLKO_005 1697 CDS 100% 15.000 12.000 N DIDO1 n/a
5 TRCN0000015094 GCCTCACAACAACAGGTTTAT pLKO.1 1049 CDS 100% 13.200 9.240 N DIDO1 n/a
6 TRCN0000015097 GCAGATCAGCAGGAAGCTAAA pLKO.1 1221 CDS 100% 10.800 7.560 N DIDO1 n/a
7 TRCN0000015095 CCAAGGGATAAAGGGTAGAAT pLKO.1 1313 CDS 100% 5.625 3.938 N DIDO1 n/a
8 TRCN0000074350 CCTCATCCCAACCAGTTTGAA pLKO.1 6150 CDS 100% 5.625 3.938 N DIDO1 n/a
9 TRCN0000074352 ACGAATACAGAAACCAGACTT pLKO.1 6559 CDS 100% 4.950 3.465 N DIDO1 n/a
10 TRCN0000194338 CAGCCTCACAACAACAGGTTT pLKO.1 1047 CDS 100% 4.950 3.465 N Dido1 n/a
11 TRCN0000074349 CGAATACAGAAACCAGACTTT pLKO.1 6560 CDS 100% 4.950 3.465 N DIDO1 n/a
12 TRCN0000074348 CCACGATCTTAGATTCAGGAT pLKO.1 7130 3UTR 100% 2.640 1.848 N DIDO1 n/a
13 TRCN0000074351 CAGAAGAGAATATCGCTTCTA pLKO.1 5677 CDS 100% 0.495 0.347 N DIDO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02618 pDONR223 100% 24.3% 23.4% None (many diffs) n/a
2 ccsbBroad304_02618 pLX_304 0% 24.3% 23.4% V5 (many diffs) n/a
3 TRCN0000468117 ATCGTACAAGACCGAACAACTTTA pLX_317 25.9% 24.3% 23.4% V5 (many diffs) n/a
4 ccsbBroadEn_11591 pDONR223 100% 23.5% 23.2% None (many diffs) n/a
5 ccsbBroad304_11591 pLX_304 0% 23.5% 23.2% V5 (many diffs) n/a
6 TRCN0000474152 CATGTTCATTACTTCGACCCTCAA pLX_317 16.5% 23.5% 23.2% V5 (many diffs) n/a
7 ccsbBroadEn_15737 pDONR223 0% 20.9% 20.9% None 1_5394del;6151G>C n/a
8 ccsbBroad304_15737 pLX_304 0% 20.9% 20.9% V5 1_5394del;6151G>C n/a
9 TRCN0000474065 CCAGGAACCAGCGAGACGCACCCG pLX_317 36.2% 20.9% 20.9% V5 1_5394del;6151G>C n/a
Download CSV