Transcript: Human XM_011528901.2

PREDICTED: Homo sapiens ADP ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARFGAP1 (55738)
Length:
3280
CDS:
113..1363

Additional Resources:

NCBI RefSeq record:
XM_011528901.2
NBCI Gene record:
ARFGAP1 (55738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293964 GCCAGTTCACTACGCAGTATC pLKO_005 1690 3UTR 100% 10.800 15.120 N ARFGAP1 n/a
2 TRCN0000047318 GCGCTCTGTTACTATGGACAA pLKO.1 289 CDS 100% 4.050 5.670 N ARFGAP1 n/a
3 TRCN0000286509 GCGCTCTGTTACTATGGACAA pLKO_005 289 CDS 100% 4.050 5.670 N ARFGAP1 n/a
4 TRCN0000047322 GTGCAGGATGAGAACAACGTT pLKO.1 155 CDS 100% 3.000 4.200 N ARFGAP1 n/a
5 TRCN0000311679 GTGCAGGATGAGAACAACGTT pLKO_005 155 CDS 100% 3.000 4.200 N ARFGAP1 n/a
6 TRCN0000047320 GCTACAAAGTTTGGATCCCAA pLKO.1 797 CDS 100% 2.640 3.696 N ARFGAP1 n/a
7 TRCN0000047319 CCGCCTCAGAAGAAAGAAGAT pLKO.1 683 CDS 100% 4.950 3.465 N ARFGAP1 n/a
8 TRCN0000286575 CCGCCTCAGAAGAAAGAAGAT pLKO_005 683 CDS 100% 4.950 3.465 N ARFGAP1 n/a
9 TRCN0000047321 GAATGCTAAGTTCCGAGAGTT pLKO.1 349 CDS 100% 4.950 3.465 N ARFGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03644 pDONR223 100% 99.5% 99.5% None 863_868delAGGTCC n/a
2 ccsbBroad304_03644 pLX_304 0% 99.5% 99.5% V5 863_868delAGGTCC n/a
3 TRCN0000470622 CCATGCCGACCTGTAGCTGACCCT pLX_317 33.9% 99.5% 99.5% V5 863_868delAGGTCC n/a
4 ccsbBroadEn_15912 pDONR223 0% 65.2% 65.3% None 717_746del;864_865ins239;1001_1248del n/a
5 ccsbBroad304_15912 pLX_304 0% 65.2% 65.3% V5 717_746del;864_865ins239;1001_1248del n/a
6 TRCN0000473949 AACGGCAACTTGAGGACCGCGATG pLX_317 37.2% 65.2% 65.3% V5 717_746del;864_865ins239;1001_1248del n/a
Download CSV