Transcript: Human XM_011528999.3

PREDICTED: Homo sapiens lipin 3 (LPIN3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPIN3 (64900)
Length:
4753
CDS:
310..3036

Additional Resources:

NCBI RefSeq record:
XM_011528999.3
NBCI Gene record:
LPIN3 (64900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161215 GTGGTAGACATTGAGCTCAAT pLKO.1 499 CDS 100% 4.950 6.930 N LPIN3 n/a
2 TRCN0000163735 GACCCAAACCTAGTGGTGAAA pLKO.1 1738 CDS 100% 4.950 3.960 N LPIN3 n/a
3 TRCN0000159343 GAGCTCATAAAGAACCACAAA pLKO.1 2866 CDS 100% 4.950 3.960 N LPIN3 n/a
4 TRCN0000162539 CGTACCTGAATTTCTCACCTT pLKO.1 4378 3UTR 100% 2.640 2.112 N LPIN3 n/a
5 TRCN0000163153 GCCCAATGATGTCTTTGCCTA pLKO.1 2781 CDS 100% 2.640 2.112 N LPIN3 n/a
6 TRCN0000159919 CAACCCTGAATACAGTAACTT pLKO.1 2964 CDS 100% 5.625 3.938 N LPIN3 n/a
7 TRCN0000160473 CCACTGTCTTTGAAGAAAGTA pLKO.1 4109 3UTR 100% 5.625 3.938 N LPIN3 n/a
8 TRCN0000164433 CCAGACATCACTGCCAACATA pLKO.1 3818 3UTR 100% 5.625 3.938 N LPIN3 n/a
9 TRCN0000164527 CTGCAAGAAGGTGCCAATGAT pLKO.1 2128 CDS 100% 5.625 3.938 N LPIN3 n/a
10 TRCN0000164432 CTTTGGGAATAGGCCCAATGA pLKO.1 2769 CDS 100% 0.495 0.347 N LPIN3 n/a
11 TRCN0000162391 CTGGACACAGTGGATACAATA pLKO.1 1606 CDS 100% 13.200 7.920 N LPIN3 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3526 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3563 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3563 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528999.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12504 pDONR223 100% 88.5% 89.4% None 2043_2287del;2362_2363ins77 n/a
2 ccsbBroad304_12504 pLX_304 0% 88.5% 89.4% V5 2043_2287del;2362_2363ins77 n/a
3 TRCN0000479685 TCGTGGTTTTAGTCAGATAAGTGT pLX_317 11.1% 88.5% 89.4% V5 2043_2287del;2362_2363ins77 n/a
Download CSV