Transcript: Human XM_011529134.2

PREDICTED: Homo sapiens signal regulatory protein beta 1 (SIRPB1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIRPB1 (10326)
Length:
1317
CDS:
151..1296

Additional Resources:

NCBI RefSeq record:
XM_011529134.2
NBCI Gene record:
SIRPB1 (10326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029800 TCCTAGTCCTTTCCTGCTGAT pLKO.1 180 CDS 100% 4.050 2.430 N SIRPB1 n/a
2 TRCN0000002686 GCTGGCTCCTGGTGAATGTAT pLKO.1 1088 CDS 100% 5.625 2.813 Y SIRPA n/a
3 TRCN0000297747 GCTGGCTCCTGGTGAATGTAT pLKO_005 1088 CDS 100% 5.625 2.813 Y SIRPA n/a
4 TRCN0000029807 CCTCACAAAGAGAAACAACAT pLKO.1 432 CDS 100% 4.950 2.475 Y SIRPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08532 pDONR223 100% 84.6% 73.8% None (many diffs) n/a
2 ccsbBroad304_08532 pLX_304 0% 84.6% 73.8% V5 (many diffs) n/a
3 ccsbBroadEn_13209 pDONR223 100% 69.4% 64.5% None (many diffs) n/a
4 ccsbBroad304_13209 pLX_304 0% 69.4% 64.5% V5 (many diffs) n/a
5 TRCN0000465242 AACCCCGAAGTTTGTATTGGCTTT pLX_317 23.2% 69.4% 64.5% V5 (many diffs) n/a
Download CSV