Transcript: Human XM_011529286.2

PREDICTED: Homo sapiens signal regulatory protein gamma (SIRPG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIRPG (55423)
Length:
1763
CDS:
212..1276

Additional Resources:

NCBI RefSeq record:
XM_011529286.2
NBCI Gene record:
SIRPG (55423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430183 TTACTGCGCTGCTCCTCATAG pLKO_005 1209 CDS 100% 10.800 8.640 N SIRPG n/a
2 TRCN0000029805 CCCTGAGAACGTGGAGTTTAA pLKO.1 490 CDS 100% 13.200 9.240 N SIRPG n/a
3 TRCN0000424394 CGCCTTGAGACTGACCGTAAA pLKO_005 1593 3UTR 100% 10.800 7.560 N SIRPG n/a
4 TRCN0000029808 GAGATGGCTTTGGGTGCCAAA pLKO.1 527 CDS 100% 4.050 2.835 N SIRPG n/a
5 TRCN0000029804 CTGGTGAACATATCTGACCAA pLKO.1 1055 CDS 100% 2.640 1.848 N SIRPG n/a
6 TRCN0000029806 CGGCACATACTACTGTGTGAA pLKO.1 454 CDS 100% 4.950 2.970 N SIRPG n/a
7 TRCN0000029807 CCTCACAAAGAGAAACAACAT pLKO.1 391 CDS 100% 4.950 2.475 Y SIRPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08532 pDONR223 100% 91.3% 91.4% None 0_1ins99;996C>T;1041C>T n/a
2 ccsbBroad304_08532 pLX_304 0% 91.3% 91.4% V5 0_1ins99;996C>T;1041C>T n/a
3 ccsbBroadEn_13209 pDONR223 100% 60.9% 51.9% None (many diffs) n/a
4 ccsbBroad304_13209 pLX_304 0% 60.9% 51.9% V5 (many diffs) n/a
5 TRCN0000465242 AACCCCGAAGTTTGTATTGGCTTT pLX_317 23.2% 60.9% 51.9% V5 (many diffs) n/a
Download CSV