Transcript: Human XM_011529287.2

PREDICTED: Homo sapiens signal regulatory protein gamma (SIRPG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIRPG (55423)
Length:
985
CDS:
69..857

Additional Resources:

NCBI RefSeq record:
XM_011529287.2
NBCI Gene record:
SIRPG (55423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029805 CCCTGAGAACGTGGAGTTTAA pLKO.1 446 CDS 100% 13.200 9.240 N SIRPG n/a
2 TRCN0000029808 GAGATGGCTTTGGGTGCCAAA pLKO.1 483 CDS 100% 4.050 2.835 N SIRPG n/a
3 TRCN0000029806 CGGCACATACTACTGTGTGAA pLKO.1 410 CDS 100% 4.950 2.970 N SIRPG n/a
4 TRCN0000029807 CCTCACAAAGAGAAACAACAT pLKO.1 347 CDS 100% 4.950 2.475 Y SIRPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08532 pDONR223 100% 66.9% 65.1% None (many diffs) n/a
2 ccsbBroad304_08532 pLX_304 0% 66.9% 65.1% V5 (many diffs) n/a
3 ccsbBroadEn_13209 pDONR223 100% 44.4% 37% None (many diffs) n/a
4 ccsbBroad304_13209 pLX_304 0% 44.4% 37% V5 (many diffs) n/a
5 TRCN0000465242 AACCCCGAAGTTTGTATTGGCTTT pLX_317 23.2% 44.4% 37% V5 (many diffs) n/a
Download CSV