Transcript: Human XM_011531802.3

PREDICTED: Homo sapiens solute carrier family 7 member 11 (SLC7A11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC7A11 (23657)
Length:
1821
CDS:
281..1801

Additional Resources:

NCBI RefSeq record:
XM_011531802.3
NBCI Gene record:
SLC7A11 (23657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043127 GCTGATTTATCTTCGATACAA pLKO.1 1498 CDS 100% 5.625 7.875 N SLC7A11 n/a
2 TRCN0000043125 CCTGCGTATTATCTCTTTATT pLKO.1 1664 CDS 100% 15.000 10.500 N SLC7A11 n/a
3 TRCN0000288865 CCTGCGTATTATCTCTTTATT pLKO_005 1664 CDS 100% 15.000 10.500 N SLC7A11 n/a
4 TRCN0000380471 CCCTCTATTCGGACCCATTTA pLKO_005 1605 CDS 100% 13.200 9.240 N SLC7A11 n/a
5 TRCN0000043124 GCACCCTTTGACAATGATAAT pLKO.1 1396 CDS 100% 13.200 9.240 N SLC7A11 n/a
6 TRCN0000288866 GCACCCTTTGACAATGATAAT pLKO_005 1396 CDS 100% 13.200 9.240 N SLC7A11 n/a
7 TRCN0000382445 CATTAGCAGTTCCGATCTTTG pLKO_005 1227 CDS 100% 10.800 7.560 N SLC7A11 n/a
8 TRCN0000043126 CCCTGGAGTTATGCAGCTAAT pLKO.1 901 CDS 100% 10.800 7.560 N SLC7A11 n/a
9 TRCN0000288926 CCCTGGAGTTATGCAGCTAAT pLKO_005 901 CDS 100% 10.800 7.560 N SLC7A11 n/a
10 TRCN0000380361 TGGAAGTCTTTGGTCCATTAC pLKO_005 624 CDS 100% 10.800 7.560 N SLC7A11 n/a
11 TRCN0000043123 CCTGTCACTATTTGGAGCTTT pLKO.1 544 CDS 100% 4.950 3.465 N SLC7A11 n/a
12 TRCN0000288927 CCTGTCACTATTTGGAGCTTT pLKO_005 544 CDS 100% 4.950 3.465 N SLC7A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02826 pDONR223 100% 96.9% 95.6% None (many diffs) n/a
2 ccsbBroad304_02826 pLX_304 0% 96.9% 95.6% V5 (many diffs) n/a
3 TRCN0000466827 TCCGGAGTGCATATCCTCCCTTAC pLX_317 30.4% 96.9% 95.6% V5 (many diffs) n/a
Download CSV