Transcript: Human XM_011532102.1

PREDICTED: Homo sapiens BMP2 inducible kinase (BMP2K), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMP2K (55589)
Length:
2442
CDS:
142..2220

Additional Resources:

NCBI RefSeq record:
XM_011532102.1
NBCI Gene record:
BMP2K (55589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000916 GATGGTGGGAACTATGTACTT pLKO.1 709 CDS 100% 4.950 6.930 N BMP2K n/a
2 TRCN0000219031 CCAGTCTCCAACATCAATAAT pLKO_005 1111 CDS 100% 15.000 10.500 N BMP2K n/a
3 TRCN0000226439 CGGAACATAGACCTGATATAT pLKO_005 1046 CDS 100% 15.000 10.500 N BMP2K n/a
4 TRCN0000226438 CTTTGGCAGTGCCACTAATAA pLKO_005 735 CDS 100% 15.000 10.500 N BMP2K n/a
5 TRCN0000000915 GACTGTGCTGTTAATTCAATT pLKO.1 478 CDS 100% 13.200 9.240 N BMP2K n/a
6 TRCN0000194756 CCATTGCAAATTTCACAAATC pLKO.1 1955 CDS 100% 10.800 7.560 N BMP2K n/a
7 TRCN0000000914 GCACTGGGATGTCTACTCTAT pLKO.1 892 CDS 100% 4.950 3.465 N BMP2K n/a
8 TRCN0000000917 TCTTCTATTCCTTCAGCTCTT pLKO.1 1132 CDS 100% 4.050 2.835 N BMP2K n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532102.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492092 CCCCCGATGGCCCGCTTATCCTAC pLX_317 20.5% 95% 93.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15104 pDONR223 76.2% 92.6% 57.9% None (many diffs) n/a
3 ccsbBroad304_15104 pLX_304 0% 92.6% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000474847 ATTTAGCCGTGCCCAGATTTCCAA pLX_317 21% 92.6% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV