Transcript: Human XM_011532740.1

PREDICTED: Homo sapiens follicle stimulating hormone receptor (FSHR), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FSHR (2492)
Length:
1183
CDS:
99..1058

Additional Resources:

NCBI RefSeq record:
XM_011532740.1
NBCI Gene record:
FSHR (2492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003724 ACCCAACTAGATGAGCTGAAT pLKO.1 675 CDS 100% 4.950 6.930 N FSHR n/a
2 TRCN0000355675 AGCTGAATCTAAGCGATAATA pLKO_005 688 CDS 100% 15.000 10.500 N FSHR n/a
3 TRCN0000003725 GAGAGCAAGGTGACAGAGATT pLKO.1 198 CDS 100% 4.950 3.465 N FSHR n/a
4 TRCN0000368308 ATATCCAACACAGGTATTAAG pLKO_005 477 CDS 100% 13.200 7.920 N FSHR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06224 pDONR223 100% 39% 39% None 668_769del;957_957delAins1231 n/a
2 ccsbBroad304_06224 pLX_304 0% 39% 39% V5 668_769del;957_957delAins1231 n/a
3 TRCN0000473210 TTACACAAGGATTCCACTATAGCC pLX_317 14.7% 39% 39% V5 668_769del;957_957delAins1231 n/a
4 TRCN0000491816 GCTACCTCGTGCGTTACTCATTTA pLX_317 19.2% 39% 39% V5 668_769del;957_957delAins1231 n/a
5 TRCN0000488675 CCAATAACTATTTATTTGAATGAT pLX_317 15.1% 39% 39% V5 (not translated due to prior stop codon) 668_769del;957_957delAins1231 n/a
Download CSV