Transcript: Human XM_011533576.2

PREDICTED: Homo sapiens charged multivesicular body protein 2B (CHMP2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHMP2B (25978)
Length:
2410
CDS:
44..733

Additional Resources:

NCBI RefSeq record:
XM_011533576.2
NBCI Gene record:
CHMP2B (25978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436014 ATACACTTGATGACATCTTTG pLKO_005 522 CDS 100% 10.800 15.120 N CHMP2B n/a
2 TRCN0000131086 GCTTACCATCTGCCTCTACTT pLKO.1 651 CDS 100% 4.950 3.960 N CHMP2B n/a
3 TRCN0000349688 GCTTACCATCTGCCTCTACTT pLKO_005 651 CDS 100% 4.950 3.960 N CHMP2B n/a
4 TRCN0000129379 GAAGCTTACCATCTGCCTCTA pLKO.1 648 CDS 100% 4.050 3.240 N CHMP2B n/a
5 TRCN0000380919 AGGTACACAGAGGGCTATAAT pLKO_005 157 CDS 100% 15.000 10.500 N CHMP2B n/a
6 TRCN0000130897 GCTTGACACCTGCCTTAAATA pLKO.1 1321 3UTR 100% 15.000 10.500 N CHMP2B n/a
7 TRCN0000379656 CAAGGCTTTAGGAGTAGATTA pLKO_005 712 CDS 100% 13.200 9.240 N CHMP2B n/a
8 TRCN0000381607 AGGAACAGAATCGAGAGTTAC pLKO_005 135 CDS 100% 10.800 7.560 N CHMP2B n/a
9 TRCN0000370533 TACTTCTATGTCTACACAAAC pLKO_005 337 CDS 100% 10.800 7.560 N CHMP2B n/a
10 TRCN0000129922 GCAGCTTTAGAGAAACAAGAA pLKO.1 188 CDS 100% 4.950 3.465 N CHMP2B n/a
11 TRCN0000319391 GCAGCTTTAGAGAAACAAGAA pLKO_005 188 CDS 100% 4.950 3.465 N CHMP2B n/a
12 TRCN0000130815 GCCTTAAATAGCACAGACCTA pLKO.1 1332 3UTR 100% 2.640 1.848 N CHMP2B n/a
13 TRCN0000319392 GCCTTAAATAGCACAGACCTA pLKO_005 1332 3UTR 100% 2.640 1.848 N CHMP2B n/a
14 TRCN0000241152 TGACTGAAGAAATGATCAATG pLKO_005 501 CDS 100% 10.800 6.480 N Chmp2b n/a
15 TRCN0000128433 GCAGTTAACAAGAAGATGGAT pLKO.1 422 CDS 100% 3.000 1.800 N CHMP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07972 pDONR223 100% 91.8% 88.6% None (many diffs) n/a
2 ccsbBroad304_07972 pLX_304 0% 91.8% 88.6% V5 (many diffs) n/a
3 TRCN0000479680 TCCGGCCTACTACTCTTCTAATAC pLX_317 64.1% 91.8% 88.6% V5 (many diffs) n/a
Download CSV