Transcript: Human XM_011533744.2

PREDICTED: Homo sapiens macrophage stimulating 1 receptor (MST1R), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MST1R (4486)
Length:
4216
CDS:
24..3911

Additional Resources:

NCBI RefSeq record:
XM_011533744.2
NBCI Gene record:
MST1R (4486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145169 CTCGGACCACATATTCAGGA pXPR_003 AGG 2165 56% 8 0.3668 MST1R MST1R 78052
2 BRDN0001145791 GTGGCATGTTAGTCACGGTG pXPR_003 AGG 1655 43% 4 0.3286 MST1R MST1R 78051
3 BRDN0001487060 CTGCCCACCTAAGCTTACTG pXPR_003 AGG 1396 36% 2 0.0246 MST1R MST1R 78050
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003110 GCTGGCTCTCATTGGTATCAT pLKO.1 3137 CDS 100% 5.625 7.875 N MST1R n/a
2 TRCN0000315066 GCTGGCTCTCATTGGTATCAT pLKO_005 3137 CDS 100% 5.625 7.875 N MST1R n/a
3 TRCN0000121160 CATGCCATTAAGTTTGAGTAT pLKO.1 2340 CDS 100% 4.950 6.930 N MST1R n/a
4 TRCN0000121159 CGACTGCAGATTTGCTCCAAA pLKO.1 917 CDS 100% 4.950 6.930 N MST1R n/a
5 TRCN0000121148 GCGTAGATGGTGAATGTCATA pLKO.1 2509 CDS 100% 4.950 6.930 N MST1R n/a
6 TRCN0000121255 CGAGTCATTCACAGTCAAGGT pLKO.1 3359 CDS 100% 2.640 3.696 N MST1R n/a
7 TRCN0000199467 GCCTGAGTATTGCCCTGATTC pLKO.1 3632 CDS 100% 10.800 8.640 N MST1R n/a
8 TRCN0000121150 CGTGTAACTGTGGTTGAGCAA pLKO.1 576 CDS 100% 2.640 2.112 N MST1R n/a
9 TRCN0000315068 GCCATTAAGTTTGAGTATATT pLKO_005 2343 CDS 100% 15.000 10.500 N MST1R n/a
10 TRCN0000379811 CACCTTGTTCCTGCCCTTTAA pLKO_005 4000 3UTR 100% 13.200 9.240 N MST1R n/a
11 TRCN0000199246 CATGTGCTGCTGCCCTATATG pLKO.1 3180 CDS 100% 13.200 9.240 N MST1R n/a
12 TRCN0000315132 TTTCAGAGGCAATAGGTAAAT pLKO_005 4022 3UTR 100% 13.200 9.240 N MST1R n/a
13 TRCN0000003106 AGGCCCAGAATCGAATCCAAT pLKO.1 3019 CDS 100% 4.950 3.465 N MST1R n/a
14 TRCN0000121256 AGGGAGTACTATAGTGTTCAA pLKO.1 3414 CDS 100% 4.950 3.465 N MST1R n/a
15 TRCN0000121161 CAATGTGCCATCAAGTCACTA pLKO.1 3036 CDS 100% 4.950 3.465 N MST1R n/a
16 TRCN0000315065 CAATGTGCCATCAAGTCACTA pLKO_005 3036 CDS 100% 4.950 3.465 N MST1R n/a
17 TRCN0000121253 GCATCCTTCTCCGATAGTGAA pLKO.1 2820 CDS 100% 4.950 3.465 N MST1R n/a
18 TRCN0000199886 GCTGACTGTGTGGGTATCAAC pLKO.1 2379 CDS 100% 4.950 3.465 N MST1R n/a
19 TRCN0000121147 CCTTTAACTTTCAGAGGCAAT pLKO.1 4014 3UTR 100% 4.050 2.835 N MST1R n/a
20 TRCN0000003109 GAGATGAATGTGCGTCCAGAA pLKO.1 3816 CDS 100% 4.050 2.835 N MST1R n/a
21 TRCN0000199511 GCGTGACAGATGATCCTAGTG pLKO.1 826 CDS 100% 4.050 2.835 N MST1R n/a
22 TRCN0000003107 CCTCCTATTTCTACGTGGCAT pLKO.1 604 CDS 100% 2.640 1.848 N MST1R n/a
23 TRCN0000121151 GCCAGCATCTAACTTCAGCAT pLKO.1 2074 CDS 100% 2.640 1.848 N MST1R n/a
24 TRCN0000350482 GCCAGCATCTAACTTCAGCAT pLKO_005 2074 CDS 100% 2.640 1.848 N MST1R n/a
25 TRCN0000195385 CGACAGAAATGAGAGTGCTGT pLKO.1 212 CDS 100% 2.640 1.584 N MST1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14703 pDONR223 0% 92.3% 92.3% None 1229_1230ins318;2121_2123delGCA n/a
2 ccsbBroad304_14703 pLX_304 0% 92.3% 92.3% V5 1229_1230ins318;2121_2123delGCA n/a
3 TRCN0000472925 CTACATAGTGTTTTCCCTGGGCCG pLX_317 9.4% 92.3% 92.3% V5 (not translated due to prior stop codon) 1229_1230ins318;2121_2123delGCA n/a
4 TRCN0000487813 ATCGCGGACGGGTAACACGACAAT pLX_317 5.2% 92.2% 92.2% V5 (many diffs) n/a
5 TRCN0000488067 CAGCGCATTGGAACGAACTAACGC pLX_317 6.8% 92.2% 92.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489728 CGAACTACTTACCTAATCGTGGGA pLX_317 22% 31.3% 1.2% V5 (not translated due to prior stop codon) 1_2665del;3039C>A;3688A>G n/a
Download CSV