Construct: ORF TRCN0000489728
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021699.1_s317c1
- DNA Barcode:
- CGAACTACTTACCTAATCGTGGGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MST1R (4486)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489728
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4486 | MST1R | macrophage stimulating 1 re... | NM_001318913.1 | 31.3% | 1.3% | 1_2662del;3036C>A;3685A>G |
| 2 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533744.2 | 31.3% | 1.2% | 1_2665del;3039C>A;3688A>G |
| 3 | human | 4486 | MST1R | macrophage stimulating 1 re... | NM_001244937.3 | 30% | 1.3% | 1_2833del;3207C>A;3856A>G |
| 4 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533740.2 | 30% | 1.3% | 1_2836del;3210C>A;3859A>G |
| 5 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533739.2 | 29.8% | 1.6% | 1_2863del;3237C>A;3886A>G |
| 6 | human | 4486 | MST1R | macrophage stimulating 1 re... | NM_002447.4 | 29% | 1.2% | 1_2980del;3354C>A;4003A>G |
| 7 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_005265170.4 | 28.9% | 1.1% | 1_2983del;3357C>A;4006A>G |
| 8 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533741.2 | 28.3% | 1.2% | (many diffs) |
| 9 | human | 4486 | MST1R | macrophage stimulating 1 re... | XR_001740155.1 | 24.3% | (many diffs) | |
| 10 | human | 4486 | MST1R | macrophage stimulating 1 re... | NR_134919.2 | 24.1% | (many diffs) | |
| 11 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533742.2 | 23.4% | 1.2% | (many diffs) |
| 12 | human | 4486 | MST1R | macrophage stimulating 1 re... | XM_011533743.2 | 21.7% | 1.2% | (many diffs) |
| 13 | human | 4486 | MST1R | macrophage stimulating 1 re... | XR_940428.2 | 16.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 70
- ORF end:
- 265
- ORF length:
- 195
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttgaa tgacctggca tccctggacc agactgctgg agccacaccc ctgcctattc 121 tgtactcggg ctctgactac agaagtggcc ttgcactccc tgccattgat ggtctggatt 181 ccaccacttg tgtccatgga gcatccttct ccgatagtga agatgaatcc tgtgtgccac 241 tgctgcggaa agagtccatc cagctaaggg acctggactc tgcgctcttg gctgaggtca 301 aggatgtgct gattccccat gagcgggtgg tcacccacag tgaccgagtc attggcaaag 361 gccactttgg agttgtctac cacggagaat acatagacca ggcccagaat cgaatccaat 421 gtgccatcaa gtcactaagt cgaatcacag agatgcagca ggtggaggcc ttcctgcgag 481 aggggctgct catgcgtggc ctgaaccacc cgaatgtgct ggctctcatt ggtatcatgt 541 tgccacctga gggcctgccc catgtgctgc tgccctatat gtgccacggt gacctgctcc 601 agttcatccg ctcacctcag cggaacccca ccgtgaagga cctcatcagc tttggcctgc 661 aggtagcccg cggcatggag tacctggcag agcagaagtt tgtgcacagg gacctggctg 721 cgcggaactg catgctggac gagtcattca cagtcaaggt ggctgacttt ggtttggccc 781 gcgacatcct ggacagggag tactatagtg ttcaacagca tcgccacgct cgcctacctg 841 tgaagtggat ggcgctggag agcctgcaga cctatagatt taccaccaag tctgatgtgt 901 ggtcatttgg tgtgctgctg tgggaactgc tgacacgggg tgccccacca taccgccaca 961 ttgacccttt tgaccttacc cacttcctgg cccagggtcg gcgcctgccc cagcctgagt 1021 attgccctGA TTCTCTGTAC CAAGTGATGC AGCAATGCTG GGAGGCAGAC CCAGCAGTGC 1081 GACCCACCTT CGGAGTACTA GTGGGGGAGG TGGAGCAGAT AGTGTCTGCA CTGCTTGGGG 1141 ACCATTATGT GCAGCTGCCA GCAACCTACA TGAACTTGGG CCCCAGCACC TCGCATGAGA 1201 TGAATGTGCG TCCAGAACAG CCGCAGTTCT CACCCATGCC AGGGAATGTA CGCCGGCCCC 1261 GGCCACTCTC AGAGCCTCCT CGGCCCACTT GAGACCCAGC TTTCTTGTAC AAAGTGGTTG 1321 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1381 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACG 1441 AACTACTTAC CTAATCGTGG GAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1501 ttgtgaaaga tt