Transcript: Human XM_011534154.3

PREDICTED: Homo sapiens chromosome 3 open reading frame 20 (C3orf20), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf20 (84077)
Length:
4584
CDS:
1946..4423

Additional Resources:

NCBI RefSeq record:
XM_011534154.3
NBCI Gene record:
C3orf20 (84077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417025 CTCTGGAAACGTCGCTGTATG pLKO_005 2746 CDS 100% 10.800 15.120 N C3orf20 n/a
2 TRCN0000166352 CTTCCGGTCTCAACAGGATTA pLKO.1 4015 CDS 100% 10.800 15.120 N C3orf20 n/a
3 TRCN0000160028 CAAGTTTCATTACACCTTCTA pLKO.1 2698 CDS 100% 4.950 6.930 N C3orf20 n/a
4 TRCN0000160641 CCAAGCTTCTATAATAAACCA pLKO.1 4522 3UTR 100% 3.000 2.400 N C3orf20 n/a
5 TRCN0000417199 AGGAGTTGTGTCGCCACATAG pLKO_005 2439 CDS 100% 10.800 7.560 N C3orf20 n/a
6 TRCN0000418240 GATGGCTCCTCCTTCGTTTAC pLKO_005 2720 CDS 100% 10.800 7.560 N C3orf20 n/a
7 TRCN0000165217 GCTGAGATCAAGAAGCGGTTT pLKO.1 3203 CDS 100% 4.050 2.835 N C3orf20 n/a
8 TRCN0000160477 CTTCAAGTTTCATTACACCTT pLKO.1 2695 CDS 100% 2.640 1.848 N C3orf20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04325 pDONR223 100% 94.7% 94.7% None 2129_2257del n/a
2 ccsbBroad304_04325 pLX_304 0% 94.7% 94.7% V5 2129_2257del n/a
3 TRCN0000470196 CGTCAGGCTCCCCTGTCCCTCTAC pLX_317 12.2% 94.7% 94.7% V5 2129_2257del n/a
Download CSV