Transcript: Human XM_011534301.3

PREDICTED: Homo sapiens SLIT-ROBO Rho GTPase activating protein 3 (SRGAP3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRGAP3 (9901)
Length:
10807
CDS:
3054..5879

Additional Resources:

NCBI RefSeq record:
XM_011534301.3
NBCI Gene record:
SRGAP3 (9901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534301.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414719 CATTCTCTCTACATACGTATA pLKO_005 6203 3UTR 100% 10.800 15.120 N SRGAP3 n/a
2 TRCN0000047563 CGCAGCTATAAGCAAATACTA pLKO.1 3317 CDS 100% 5.625 7.875 N SRGAP3 n/a
3 TRCN0000047567 GCGTGAGCTATCCTTCAAGAA pLKO.1 4859 CDS 100% 4.950 6.930 N SRGAP3 n/a
4 TRCN0000415318 ACATGGCTTCTCCCGCATATC pLKO_005 6158 3UTR 100% 10.800 8.640 N SRGAP3 n/a
5 TRCN0000436734 ACGGAGCACATCTCGGATTAC pLKO_005 5094 CDS 100% 10.800 7.560 N SRGAP3 n/a
6 TRCN0000047566 CGCAGCTCTGTGAAGAAGATT pLKO.1 3198 CDS 100% 5.625 3.938 N SRGAP3 n/a
7 TRCN0000047565 GCCACCCTCAAGATAGAGAAT pLKO.1 3663 CDS 100% 4.950 3.465 N SRGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534301.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11429 pDONR223 100% 29% 28.5% None (many diffs) n/a
2 ccsbBroad304_11429 pLX_304 0% 29% 28.5% V5 (many diffs) n/a
3 TRCN0000467233 TAACACCTGACTCACCTCTCTGGT pLX_317 27% 29% 28.5% V5 (many diffs) n/a
Download CSV