Transcript: Human XM_011535014.1

PREDICTED: Homo sapiens fms related tyrosine kinase 1 (FLT1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLT1 (2321)
Length:
2463
CDS:
286..2448

Additional Resources:

NCBI RefSeq record:
XM_011535014.1
NBCI Gene record:
FLT1 (2321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230834 ACTCGTGGCTACTCGTTAATT pLKO_005 1438 CDS 100% 15.000 21.000 N FLT1 n/a
2 TRCN0000000633 CGCCGGAAGTTGTATGGTTAA pLKO.1 1376 CDS 100% 10.800 15.120 N FLT1 n/a
3 TRCN0000194670 CGTAGAGATGTACAGTGAAAT pLKO.1 690 CDS 100% 13.200 10.560 N FLT1 n/a
4 TRCN0000230833 GCCGGAAGTTGTATGGTTAAA pLKO_005 1377 CDS 100% 13.200 9.240 N FLT1 n/a
5 TRCN0000000635 CTTGACACTTTGATCCCTGAT pLKO.1 805 CDS 100% 4.050 2.835 N FLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00580 pDONR223 100% 93.6% 90.4% None (many diffs) n/a
2 ccsbBroad304_00580 pLX_304 0% 93.6% 90.4% V5 (many diffs) n/a
3 TRCN0000479303 CACAGAAACCATGCTGTTGTAAAG pLX_317 19.1% 93.6% 90.4% V5 (many diffs) n/a
4 ccsbBroadEn_14643 pDONR223 0% 53.2% 52.7% None (many diffs) n/a
5 ccsbBroad304_14643 pLX_304 0% 53.2% 52.7% V5 (many diffs) n/a
6 TRCN0000472926 TTACTCCGCGAACAAACAATAACA pLX_317 9.6% 53.2% 52.7% V5 (many diffs) n/a
Download CSV