Transcript: Human XM_011535728.3

PREDICTED: Homo sapiens coiled-coil domain containing 28A (CCDC28A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC28A (25901)
Length:
1675
CDS:
159..755

Additional Resources:

NCBI RefSeq record:
XM_011535728.3
NBCI Gene record:
CCDC28A (25901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063110 GCTGTACCTCTTACGTCACTT pLKO.1 230 CDS 100% 4.950 3.960 N CCDC28A n/a
2 TRCN0000303528 CCTTCTTCTTCAGGTCTTAAG pLKO_005 374 CDS 100% 10.800 7.560 N CCDC28A n/a
3 TRCN0000063109 CGTGGTGCAATAAGGAACTTA pLKO.1 403 CDS 100% 5.625 3.938 N CCDC28A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11781 pDONR223 100% 31.1% 30.6% None 1_337del;342_343insA;594_594delTins229 n/a
2 ccsbBroad304_11781 pLX_304 0% 31.1% 30.6% V5 1_337del;342_343insA;594_594delTins229 n/a
3 TRCN0000472256 TCACCCTCTCAATAATTGGGGCGG pLX_317 75.2% 31.1% 30.6% V5 1_337del;342_343insA;594_594delTins229 n/a
4 ccsbBroadEn_11780 pDONR223 100% 19.5% 19.7% None 1_432del;594_594delTins229 n/a
5 ccsbBroad304_11780 pLX_304 0% 19.5% 19.7% V5 1_432del;594_594delTins229 n/a
6 TRCN0000478880 CCAGACGGCGAAGTGCTCAGCGTA pLX_317 84.8% 19.5% 19.7% V5 1_432del;594_594delTins229 n/a
Download CSV