Transcript: Human XM_011535762.2

PREDICTED: Homo sapiens centrosomal protein 57 like 1 (CEP57L1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP57L1 (285753)
Length:
5873
CDS:
167..1147

Additional Resources:

NCBI RefSeq record:
XM_011535762.2
NBCI Gene record:
CEP57L1 (285753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425654 GAACATCAGCGTAAGCTATTT pLKO_005 332 CDS 100% 13.200 18.480 N CEP57L1 n/a
2 TRCN0000150697 GCTGAGGACAAGATTAAACAT pLKO.1 287 CDS 100% 5.625 7.875 N CEP57L1 n/a
3 TRCN0000418640 TAGTAGGTTTGGAACCTTAAA pLKO_005 1500 3UTR 100% 13.200 10.560 N CEP57L1 n/a
4 TRCN0000155059 GCAGAAGCTTTCCTCTGCTAT pLKO.1 1731 3UTR 100% 0.495 0.396 N CEP57L1 n/a
5 TRCN0000427845 GACGACCACCTTGGCAAATTT pLKO_005 477 CDS 100% 15.000 10.500 N CEP57L1 n/a
6 TRCN0000151002 CATCAAGACAGTGTCTGTAAA pLKO.1 914 CDS 100% 13.200 9.240 N CEP57L1 n/a
7 TRCN0000432742 ATTCAGTCTGTGACGACATAG pLKO_005 825 CDS 100% 10.800 7.560 N CEP57L1 n/a
8 TRCN0000155079 GCAAGAAGACAGCTACCCTAA pLKO.1 985 CDS 100% 4.050 2.430 N CEP57L1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4817 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5597 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4817 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05407 pDONR223 99% 64.7% 64.1% None (many diffs) n/a
2 ccsbBroad304_05407 pLX_304 0% 64.7% 64.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14466 pDONR223 100% 20.5% 19.4% None (many diffs) n/a
4 ccsbBroad304_14466 pLX_304 0% 20.5% 19.4% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000475203 CGTCGGAGACTTGGCAAAATACGA pLX_317 62.6% 20.5% 19.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV