Transcript: Human XM_011536096.2

PREDICTED: Homo sapiens TNF alpha induced protein 3 (TNFAIP3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFAIP3 (7128)
Length:
4524
CDS:
341..2410

Additional Resources:

NCBI RefSeq record:
XM_011536096.2
NBCI Gene record:
TNFAIP3 (7128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050961 CACTGGAAGAAATACACATAT pLKO.1 909 CDS 100% 13.200 9.240 N TNFAIP3 n/a
2 TRCN0000050958 CGGCTATGACAGCCATCATTT pLKO.1 1090 CDS 100% 13.200 9.240 N TNFAIP3 n/a
3 TRCN0000218748 GATGAAGGAGAAGCTCTTAAA pLKO_005 1231 CDS 100% 13.200 9.240 N TNFAIP3 n/a
4 TRCN0000229324 TGTAACTCTTTGGGTTATTAC pLKO_005 3244 3UTR 100% 13.200 9.240 N TNFAIP3 n/a
5 TRCN0000218517 AGTTGGATGAAGCTAACTTAC pLKO_005 1326 CDS 100% 10.800 7.560 N TNFAIP3 n/a
6 TRCN0000229323 ATCTGGTAGATGATTACTTTG pLKO_005 1359 CDS 100% 10.800 7.560 N TNFAIP3 n/a
7 TRCN0000050959 GCACCGATACACACTGGAAAT pLKO.1 469 CDS 100% 10.800 7.560 N TNFAIP3 n/a
8 TRCN0000050960 CCAGGATGTTACCAGGACATT pLKO.1 1915 CDS 100% 4.950 3.465 N TNFAIP3 n/a
9 TRCN0000219022 TTGGAATCAGGTTCCAATTTC pLKO_005 992 CDS 100% 1.320 0.924 N TNFAIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01686 pDONR223 100% 87.2% 82.4% None 1906_1907ins182;2067_2068ins121 n/a
2 ccsbBroad304_01686 pLX_304 27.8% 87.1% 83.9% V5 (not translated due to prior stop codon) 1757delC;1906_1907ins182;2067_2068ins121 n/a
3 ccsbBroadEn_11197 pDONR223 100% 34.5% 32% None (many diffs) n/a
4 ccsbBroad304_11197 pLX_304 0% 34.5% 32% V5 (many diffs) n/a
5 TRCN0000472676 TCCTGCTTCATCACAGCACTAGCA pLX_317 58.2% 34.5% 32% V5 (many diffs) n/a
Download CSV