Transcript: Human XM_011537337.2

PREDICTED: Homo sapiens WD repeat domain 20 (WDR20), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR20 (91833)
Length:
2720
CDS:
56..1930

Additional Resources:

NCBI RefSeq record:
XM_011537337.2
NBCI Gene record:
WDR20 (91833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138725 GTCACGAGTTACCTGTGTCAA pLKO.1 631 CDS 100% 4.950 6.930 N WDR20 n/a
2 TRCN0000136913 CGAGAAAGATCACAAGCGAAA pLKO.1 1606 CDS 100% 4.050 5.670 N WDR20 n/a
3 TRCN0000138946 GTGTCACGTATCGGTTTGGTT pLKO.1 1275 CDS 100% 3.000 4.200 N WDR20 n/a
4 TRCN0000138371 CGTAAGTGTCACGTATCGGTT pLKO.1 1270 CDS 100% 2.640 3.696 N WDR20 n/a
5 TRCN0000184252 GTAAACCTCAACGACCAGTCT pLKO.1 212 CDS 100% 2.640 2.112 N Wdr20 n/a
6 TRCN0000279180 AGTGGGAACATGTACTTATAT pLKO_005 695 CDS 100% 15.000 10.500 N Wdr20 n/a
7 TRCN0000138658 CCTTGTTAGAGCCGCTGATAT pLKO.1 1746 CDS 100% 13.200 9.240 N WDR20 n/a
8 TRCN0000297624 CACGAGGAACCCTCTCCTTAA pLKO_005 808 CDS 100% 10.800 7.560 N Wdr20 n/a
9 TRCN0000134401 GAACGAGATTAAGACCCAATT pLKO.1 85 CDS 100% 10.800 7.560 N WDR20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537337.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09322 pDONR223 100% 90.8% 90.3% None (many diffs) n/a
2 ccsbBroad304_09322 pLX_304 0% 90.8% 90.3% V5 (many diffs) n/a
3 TRCN0000471560 TTCCTTGAGCATGCGAAAGCAATC pLX_317 25.1% 90.8% 90.3% V5 (many diffs) n/a
4 ccsbBroadEn_16065 pDONR223 0% 29.8% 27.7% None (many diffs) n/a
5 ccsbBroad304_16065 pLX_304 0% 29.8% 27.7% V5 (many diffs) n/a
6 TRCN0000466022 TTACCAAGGATTGAGGAACCATCT pLX_317 66.6% 29.8% 27.7% V5 (many diffs) n/a
Download CSV