Transcript: Human XM_011537796.2

PREDICTED: Homo sapiens nudix hydrolase 4 (NUDT4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUDT4 (11163)
Length:
4041
CDS:
241..627

Additional Resources:

NCBI RefSeq record:
XM_011537796.2
NBCI Gene record:
NUDT4 (11163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296266 TTTGAGAACCAAGACCGAAAG pLKO_005 334 CDS 100% 6.000 4.200 N NUDT4 n/a
2 TRCN0000051959 CTGGGCATATTTGAGAACCAA pLKO.1 325 CDS 100% 3.000 2.100 N NUDT4 n/a
3 TRCN0000296267 TCCCTTCCCTTCCGGATAATA pLKO_005 551 CDS 100% 15.000 7.500 Y NUDT4 n/a
4 TRCN0000379595 TCTATTTCTCACAGCATATTT pLKO_005 894 3UTR 100% 15.000 7.500 Y NUDT4 n/a
5 TRCN0000051961 GTTCTAACAGTCACTGAAATA pLKO.1 373 CDS 100% 13.200 6.600 Y NUDT4 n/a
6 TRCN0000289588 GTTCTAACAGTCACTGAAATA pLKO_005 373 CDS 100% 13.200 6.600 Y NUDT4 n/a
7 TRCN0000050843 CCACAAATTGACACTTTCTAT pLKO.1 2542 3UTR 100% 5.625 2.813 Y NUDT4B n/a
8 TRCN0000051960 CCGGATAATAATGCCTTGTTT pLKO.1 562 CDS 100% 5.625 2.813 Y NUDT4 n/a
9 TRCN0000289586 CCGGATAATAATGCCTTGTTT pLKO_005 562 CDS 100% 5.625 2.813 Y NUDT4 n/a
10 TRCN0000051958 GTTGCCATCTAGTGTAAGATA pLKO.1 606 CDS 100% 5.625 2.813 Y NUDT4 n/a
11 TRCN0000050846 GAGTGGTTCAAAGTAGAAGAT pLKO.1 436 CDS 100% 4.950 2.475 Y NUDT4B n/a
12 TRCN0000051962 CTCCAGTGTCATAAACCTGTA pLKO.1 469 CDS 100% 4.050 2.025 Y NUDT4 n/a
13 TRCN0000289529 CTCCAGTGTCATAAACCTGTA pLKO_005 469 CDS 100% 4.050 2.025 Y NUDT4 n/a
14 TRCN0000050845 CGTGAGGGAAGTTTATGAGGA pLKO.1 273 CDS 100% 2.640 1.320 Y NUDT4B n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2112 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2112 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465307 CCGACAAATGACTTCGTTAGGTGT pLX_317 60.3% 71.1% 71.1% V5 0_1ins156 n/a
2 ccsbBroadEn_14064 pDONR223 100% 70.6% 17.7% None 0_1ins156;98_98delAinsNAN n/a
3 ccsbBroad304_14064 pLX_304 0% 70.6% 17.7% V5 (not translated due to prior stop codon) 0_1ins156;98_98delAinsNAN n/a
Download CSV