Transcript: Human XM_011537989.3

PREDICTED: Homo sapiens aldehyde dehydrogenase 1 family member L2 (ALDH1L2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALDH1L2 (160428)
Length:
1671
CDS:
23..1573

Additional Resources:

NCBI RefSeq record:
XM_011537989.3
NBCI Gene record:
ALDH1L2 (160428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537989.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422521 AGCTGAAGTTGGCACTAATTG pLKO_005 87 CDS 100% 13.200 18.480 N ALDH1L2 n/a
2 TRCN0000155970 CCTGGAGAACCACTGGAAATT pLKO.1 854 CDS 100% 13.200 9.240 N ALDH1L2 n/a
3 TRCN0000150510 GCCATACCAGTGTTTCATAAA pLKO.1 1345 CDS 100% 13.200 9.240 N ALDH1L2 n/a
4 TRCN0000179462 GCGGATGTTGATAAAGCAGTA pLKO.1 1460 CDS 100% 4.050 2.835 N ALDH1L2 n/a
5 TRCN0000154597 GCTTCCTAAATGGAGGGTCAA pLKO.1 253 CDS 100% 4.050 2.835 N ALDH1L2 n/a
6 TRCN0000151018 GCTCTATCATTTATCACCCAT pLKO.1 390 CDS 100% 2.640 1.848 N ALDH1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537989.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10320 pDONR223 100% 33.7% 33.2% None (many diffs) n/a
2 ccsbBroad304_10320 pLX_304 0% 33.7% 33.2% V5 (many diffs) n/a
3 TRCN0000474398 TGCAGATCTCCTTCAACGTGGCGC pLX_317 35% 33.7% 33.2% V5 (many diffs) n/a
Download CSV