Transcript: Human XM_011538229.3

PREDICTED: Homo sapiens kinase suppressor of ras 2 (KSR2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KSR2 (283455)
Length:
2286
CDS:
303..2162

Additional Resources:

NCBI RefSeq record:
XM_011538229.3
NBCI Gene record:
KSR2 (283455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148172 TTAAATAGTTACCTCCTCGG pXPR_003 TGG 1388 75% 8 0.6931 KSR2 KSR2 76426
2 BRDN0001147424 CCACGTGGACAGGCTTACCG pXPR_003 TGG 682 37% 4 0.1019 KSR2 KSR2 76425
3 BRDN0001145237 AATTGAAGTGGAGCCAACGT pXPR_003 CGG 1843 99% 13 -0.0542 KSR2 KSR2 76427
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538229.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382261 AGTTAAAGTGCCACAACAAAT pLKO_005 1627 CDS 100% 13.200 18.480 N KSR2 n/a
2 TRCN0000335902 TACGGAAGCCACCTCGCTATT pLKO_005 1750 CDS 100% 10.800 15.120 N KSR2 n/a
3 TRCN0000195569 CGTTCCGTGTGACATCAACAA pLKO.1 1724 CDS 100% 4.950 3.465 N KSR2 n/a
4 TRCN0000199619 GCCTCAGGAATGTCCACATGT pLKO.1 751 CDS 100% 4.950 3.465 N KSR2 n/a
5 TRCN0000335815 GCCTCAGGAATGTCCACATGT pLKO_005 751 CDS 100% 4.950 3.465 N KSR2 n/a
6 TRCN0000199136 CGTAGGCAGCTGCGAGAACAT pLKO.1 1334 CDS 100% 1.650 1.155 N KSR2 n/a
7 TRCN0000335816 CGTAGGCAGCTGCGAGAACAT pLKO_005 1334 CDS 100% 1.650 1.155 N KSR2 n/a
8 TRCN0000199943 GCAAGGTTAGTCCGGACAGAG pLKO.1 1701 CDS 100% 1.350 0.945 N KSR2 n/a
9 TRCN0000194721 CCATTACTTCAAATTGAAGTG pLKO.1 2118 CDS 100% 0.405 0.284 N KSR2 n/a
10 TRCN0000382366 TGTGCGAGACTGTGGAGAAAT pLKO_005 682 CDS 100% 13.200 7.920 N KSR2 n/a
11 TRCN0000022631 CAAACCCTTGAACCTCAAGAT pLKO.1 1304 CDS 100% 4.950 2.970 N Gm1390 n/a
12 TRCN0000007064 CAAGTTAAAGTGCCACAACAA pLKO.1 1625 CDS 100% 4.950 2.970 N KSR2 n/a
13 TRCN0000363377 GCAAGTTAAAGTGCCACAATA pLKO_005 1624 CDS 100% 13.200 7.920 N Ksr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538229.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13499 pDONR223 100% 52.2% 52.2% None (many diffs) n/a
2 ccsbBroad304_13499 pLX_304 0% 52.2% 52.2% V5 (many diffs) n/a
3 TRCN0000475094 TCTTCTCCGAATTGTACACATATC pLX_317 14.9% 52.2% 52.2% V5 (many diffs) n/a
4 ccsbBroadEn_15297 pDONR223 56.8% 52.2% 34.2% None (many diffs) n/a
5 ccsbBroad304_15297 pLX_304 0% 52.2% 34.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000469219 CAGATTCATAAGAGAGCCTCTTCA pLX_317 12.4% 52.2% 34.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV