Transcript: Human XM_011538442.2

PREDICTED: Homo sapiens cysteine sulfinic acid decarboxylase (CSAD), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CSAD (51380)
Length:
3247
CDS:
744..2399

Additional Resources:

NCBI RefSeq record:
XM_011538442.2
NBCI Gene record:
CSAD (51380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078524 AGAGTCCAGATTACCACGAAA pLKO.1 2194 CDS 100% 4.950 6.930 N CSAD n/a
2 TRCN0000078523 CTACTAACTTTCTCCTAACTA pLKO.1 2820 3UTR 100% 5.625 3.938 N CSAD n/a
3 TRCN0000421505 AGTACGAGACTCTGTTCCAAA pLKO_005 2736 3UTR 100% 4.950 3.465 N CSAD n/a
4 TRCN0000428401 GGAAGGGTTTGAGCTAGTCAT pLKO_005 2111 CDS 100% 4.950 3.465 N CSAD n/a
5 TRCN0000078525 TGAGTTTGTCAATGTGTGTTT pLKO.1 2138 CDS 100% 4.950 3.465 N CSAD n/a
6 TRCN0000078526 GCAGGACAAGTTCTACGATGT pLKO.1 1931 CDS 100% 4.050 2.835 N CSAD n/a
7 TRCN0000078527 CCAGCCAGTACACATATGAAA pLKO.1 1162 CDS 100% 0.000 0.000 N CSAD n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2494 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2533 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2533 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2533 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2495 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11984 pDONR223 100% 89.4% 82.9% None 1_81del;649_701del;837_876del n/a
2 ccsbBroad304_11984 pLX_304 0% 89.4% 82.9% V5 1_81del;649_701del;837_876del n/a
3 TRCN0000468049 AACTATATTATAACGATGATTTGT pLX_317 15.2% 89.4% 82.9% V5 1_81del;649_701del;837_876del n/a
Download CSV