Transcript: Human XM_011539014.3

PREDICTED: Homo sapiens solute carrier family 4 member 8 (SLC4A8), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC4A8 (9498)
Length:
10431
CDS:
238..2106

Additional Resources:

NCBI RefSeq record:
XM_011539014.3
NBCI Gene record:
SLC4A8 (9498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413560 GATGATCGCGGATGGATTATT pLKO_005 1066 CDS 100% 15.000 21.000 N SLC4A8 n/a
2 TRCN0000043182 GCCTCTATTACTGCAGGTGTA pLKO.1 665 CDS 100% 4.050 2.835 N SLC4A8 n/a
3 TRCN0000043178 GCTGCAATTATCCCAGCTCTT pLKO.1 1123 CDS 100% 4.050 2.835 N SLC4A8 n/a
4 TRCN0000043180 CCGTTTCACTGAAGAAGCATT pLKO.1 540 CDS 100% 4.950 2.970 N SLC4A8 n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4832 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4833 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6314 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6314 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539014.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11376 pDONR223 100% 17.5% 16.3% None (many diffs) n/a
2 ccsbBroad304_11376 pLX_304 0% 17.5% 16.3% V5 (many diffs) n/a
3 TRCN0000479470 ACCGACTGCAGAGTCTGTATAGTC pLX_317 19.1% 17.5% 16.3% V5 (many diffs) n/a
Download CSV