Transcript: Human XM_011539663.1

PREDICTED: Homo sapiens DNA polymerase lambda (POLL), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLL (27343)
Length:
1648
CDS:
112..1077

Additional Resources:

NCBI RefSeq record:
XM_011539663.1
NBCI Gene record:
POLL (27343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438695 TGGTGCCCTATAGCGAGTTTG pLKO_005 827 CDS 100% 10.800 15.120 N POLL n/a
2 TRCN0000425960 TGTGTGGCATGTGGTTCATAC pLKO_005 562 CDS 100% 10.800 7.560 N POLL n/a
3 TRCN0000437521 TGCGGAAGCTGGACCATATCA pLKO_005 293 CDS 100% 5.625 3.938 N POLL n/a
4 TRCN0000415738 AGCCCATCTCTGATGATGAAG pLKO_005 176 CDS 100% 4.950 3.465 N POLL n/a
5 TRCN0000053129 CCTGAAGCATTACAGTGACTT pLKO.1 456 CDS 100% 4.950 3.465 N POLL n/a
6 TRCN0000447193 TGGTGATGTCGACGTGCTCAT pLKO_005 603 CDS 100% 4.050 2.835 N POLL n/a
7 TRCN0000053131 CAAGAGGAGAATGGTCAGCAA pLKO.1 739 CDS 100% 2.640 1.848 N POLL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11865 pDONR223 100% 92.8% 92.8% None 1_6delATGCTG;65_106del;579_599del n/a
2 ccsbBroad304_11865 pLX_304 0% 92.8% 92.8% V5 1_6delATGCTG;65_106del;579_599del n/a
3 TRCN0000468471 CACCTACGGTCTGTGGGAAGGCCA pLX_317 40.1% 92.8% 92.8% V5 1_6delATGCTG;65_106del;579_599del n/a
Download CSV