Transcript: Human XM_011540677.2

PREDICTED: Homo sapiens podocan (PODN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PODN (127435)
Length:
2325
CDS:
100..1308

Additional Resources:

NCBI RefSeq record:
XM_011540677.2
NBCI Gene record:
PODN (127435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152038 CAACTTAGAGTTTGGTGACAT pLKO.1 1209 CDS 100% 4.950 6.930 N PODN n/a
2 TRCN0000157135 GCAGAACAACTACCTGACTGA pLKO.1 273 CDS 100% 2.640 3.696 N PODN n/a
3 TRCN0000153180 GCATCTGACCAACCTCAATTA pLKO.1 5 5UTR 100% 13.200 10.560 N PODN n/a
4 TRCN0000157711 CGAGTCACTTGAGTACCTGTA pLKO.1 1029 CDS 100% 4.050 3.240 N PODN n/a
5 TRCN0000154039 CCTGTACTTGGCCAATAACAA pLKO.1 26 5UTR 100% 5.625 3.938 N PODN n/a
6 TRCN0000157674 GAGCATCTGACCAACCTCAAT pLKO.1 3 5UTR 100% 4.950 3.465 N PODN n/a
7 TRCN0000156400 CTGGAGAAGACACAAGGGTAT pLKO.1 1835 3UTR 100% 4.050 2.835 N PODN n/a
8 TRCN0000157932 CCTCAAGAACAACAAGCTGGA pLKO.1 198 CDS 100% 2.160 1.512 N PODN n/a
9 TRCN0000158324 CATGCACAAGTCATGTGCGAA pLKO.1 1718 3UTR 100% 0.264 0.185 N PODN n/a
10 TRCN0000153731 CCAACCTCAATTACCTGTACT pLKO.1 13 5UTR 100% 4.950 2.970 N PODN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14372 pDONR223 100% 99.6% 99.2% None (many diffs) n/a
2 ccsbBroad304_14372 pLX_304 0% 99.6% 99.2% V5 (many diffs) n/a
3 TRCN0000468136 CCCAGTTGCAGAGTGTCGAATTCC pLX_317 34.7% 99.6% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_09507 pDONR223 100% 60.7% 60.6% None 0_1ins777;624G>A;782T>C n/a
5 ccsbBroad304_09507 pLX_304 0% 60.7% 60.6% V5 0_1ins777;624G>A;782T>C n/a
6 TRCN0000479035 CTTGATCTACGCTTGTCTGCTGAA pLX_317 19.7% 60.7% 60.6% V5 0_1ins777;624G>A;782T>C n/a
Download CSV