Transcript: Human XM_011541140.2

PREDICTED: Homo sapiens isoprenylcysteine carboxyl methyltransferase (ICMT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ICMT (23463)
Length:
4515
CDS:
62..628

Additional Resources:

NCBI RefSeq record:
XM_011541140.2
NBCI Gene record:
ICMT (23463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310659 ACGGGCCTGCCTTTCATAAAG pLKO_005 587 CDS 100% 13.200 18.480 N ICMT n/a
2 TRCN0000303341 CATGGGTGAAAGACGAGTAAG pLKO_005 839 3UTR 100% 10.800 8.640 N ICMT n/a
3 TRCN0000035272 GATCGAACAGAAGAAGAAGAA pLKO.1 509 CDS 100% 4.950 3.465 N ICMT n/a
4 TRCN0000291665 GATCGAACAGAAGAAGAAGAA pLKO_005 509 CDS 100% 4.950 3.465 N ICMT n/a
5 TRCN0000035269 GCTGCTCTTTCTTCTTGGTTA pLKO.1 176 CDS 100% 4.950 3.465 N ICMT n/a
6 TRCN0000291666 GCTGCTCTTTCTTCTTGGTTA pLKO_005 176 CDS 100% 4.950 3.465 N ICMT n/a
7 TRCN0000035270 CTTCGGAGAATGTCTGAGGAA pLKO.1 277 CDS 100% 2.640 1.848 N ICMT n/a
8 TRCN0000035273 CCTGGAGTATAAGAAGAGGGT pLKO.1 562 CDS 100% 0.660 0.462 N ICMT n/a
9 TRCN0000295336 GATGGTGGTCTTCGGAGAATG pLKO_005 268 CDS 100% 10.800 6.480 N Icmt n/a
10 TRCN0000035271 GTTCCACTATTCTGAATACTT pLKO.1 79 CDS 100% 5.625 3.375 N ICMT n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3490 3UTR 100% 4.950 2.475 Y LOC387873 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3527 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3527 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15012 pDONR223 97.1% 66.1% 66.1% None 0_1ins288 n/a
2 ccsbBroad304_15012 pLX_304 0% 66.1% 66.1% V5 0_1ins288 n/a
3 TRCN0000471390 TTCTCCATATGTATTAAAACCCTC pLX_317 55.8% 66.1% 66.1% V5 0_1ins288 n/a
4 ccsbBroadEn_02772 pDONR223 100% 66.1% 66.1% None 0_1ins288 n/a
5 ccsbBroad304_02772 pLX_304 0% 66.1% 66.1% V5 0_1ins288 n/a
6 TRCN0000475593 TGCTAAATATTCTGCCCGACCCTC pLX_317 32.5% 66.1% 66.1% V5 0_1ins288 n/a
Download CSV