Transcript: Human XM_011541236.2

PREDICTED: Homo sapiens argonaute RISC component 1 (AGO1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO1 (26523)
Length:
12774
CDS:
189..2771

Additional Resources:

NCBI RefSeq record:
XM_011541236.2
NBCI Gene record:
AGO1 (26523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541236.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423811 ATCAAGCTCCTGGCCAATTAC pLKO_005 294 CDS 100% 13.200 9.240 N AGO1 n/a
2 TRCN0000007859 GCACTGTTCTTTGATTGTTTA pLKO.1 6218 3UTR 100% 13.200 9.240 N AGO1 n/a
3 TRCN0000415676 ACAATGGGATTGAGATCAAAG pLKO_005 1519 CDS 100% 10.800 7.560 N AGO1 n/a
4 TRCN0000413322 TTGAAGGCAGAACGCTGTTAC pLKO_005 2768 CDS 100% 10.800 7.560 N Ago1 n/a
5 TRCN0000007862 CCATCCCATTACTATGTTCTT pLKO.1 2475 CDS 100% 4.950 3.465 N AGO1 n/a
6 TRCN0000007863 CCTGATGAAGAATGCCAGCTA pLKO.1 1325 CDS 100% 2.640 1.848 N AGO1 n/a
7 TRCN0000007860 GCTGACAAGAATGAGCGAATT pLKO.1 2343 CDS 100% 0.000 0.000 N AGO1 n/a
8 TRCN0000007861 GCACAGTATTTCAAGCAGAAA pLKO.1 1107 CDS 100% 4.950 2.970 N AGO1 n/a
9 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 11702 3UTR 100% 13.200 6.600 Y LRRC74B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541236.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08023 pDONR223 100% 99.6% 99.5% None 724G>A;1262_1270delGGGTGAGCA n/a
2 ccsbBroad304_08023 pLX_304 0% 99.6% 99.5% V5 724G>A;1262_1270delGGGTGAGCA n/a
3 TRCN0000477689 GGCCTGACAATTTGTCATGTACTC pLX_317 19.9% 99.6% 99.5% V5 724G>A;1262_1270delGGGTGAGCA n/a
4 ccsbBroadEn_11852 pDONR223 100% 35.1% 39.3% None (many diffs) n/a
5 ccsbBroad304_11852 pLX_304 0% 35.1% 39.3% V5 (many diffs) n/a
Download CSV