Transcript: Human XM_011541432.3

PREDICTED: Homo sapiens cation channel sperm associated 4 (CATSPER4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CATSPER4 (378807)
Length:
1393
CDS:
108..1268

Additional Resources:

NCBI RefSeq record:
XM_011541432.3
NBCI Gene record:
CATSPER4 (378807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151422 GCAACGAATAACCTTTAGTGA pLKO.1 1073 CDS 100% 3.000 4.200 N CATSPER4 n/a
2 TRCN0000157205 GAGTACCATTCACGAGTCCTA pLKO.1 245 CDS 100% 2.640 2.112 N CATSPER4 n/a
3 TRCN0000157305 CGCCAGGAAATCACGAACAAA pLKO.1 297 CDS 100% 5.625 3.938 N CATSPER4 n/a
4 TRCN0000156924 GCCTGACATGGCCAATATCAT pLKO.1 740 CDS 100% 5.625 3.938 N CATSPER4 n/a
5 TRCN0000151820 CCAGAAACACTATGAGTTGTT pLKO.1 461 CDS 100% 4.950 3.465 N CATSPER4 n/a
6 TRCN0000153677 CCGAGATGAACTCAACATGAT pLKO.1 1285 3UTR 100% 4.950 3.465 N CATSPER4 n/a
7 TRCN0000154116 CTGGAACATCCTCAACTTCAT pLKO.1 572 CDS 100% 4.950 3.465 N CATSPER4 n/a
8 TRCN0000157595 GCCCAAGCATTTCCAGAACAT pLKO.1 827 CDS 100% 4.950 3.465 N CATSPER4 n/a
9 TRCN0000151400 CTTTACCATCTTCATCACCAT pLKO.1 965 CDS 100% 2.640 1.848 N CATSPER4 n/a
10 TRCN0000157108 GTACACCCTCTTCATCTGCAT pLKO.1 860 CDS 100% 2.640 1.848 N CATSPER4 n/a
11 TRCN0000154191 CGTGTTTGGAGTAACACTCTT pLKO.1 794 CDS 100% 0.495 0.347 N CATSPER4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14488 pDONR223 100% 89.5% 75.2% None (many diffs) n/a
2 ccsbBroad304_14488 pLX_304 0% 89.5% 75.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479988 AATCCCAGACTTAAATCATATAAC pLX_317 28% 89.5% 75.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_05555 pDONR223 100% 81.7% 71.6% None 985_986insAGAC;1158_1159ins254 n/a
5 ccsbBroad304_05555 pLX_304 0% 81.7% 71.6% V5 985_986insAGAC;1158_1159ins254 n/a
6 TRCN0000477480 TTCCTAAATACAGTTACCTAACCA pLX_317 34.6% 81.7% 71.6% V5 985_986insAGAC;1158_1159ins254 n/a
Download CSV