Transcript: Human XM_011542037.2

PREDICTED: Homo sapiens synaptonemal complex protein 1 (SYCP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYCP1 (6847)
Length:
2664
CDS:
208..2571

Additional Resources:

NCBI RefSeq record:
XM_011542037.2
NBCI Gene record:
SYCP1 (6847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150974 CCAATCTCAAAGCTGAACTTT pLKO.1 2468 CDS 100% 5.625 7.875 N SYCP1 n/a
2 TRCN0000151126 GCAGGTATCACTACTATTGAT pLKO.1 1005 CDS 100% 5.625 7.875 N SYCP1 n/a
3 TRCN0000151935 CACACAGGAAACAAGTGATAT pLKO.1 1797 CDS 100% 13.200 9.240 N SYCP1 n/a
4 TRCN0000360116 TGATAAGCGATGTCAACATAA pLKO_005 2304 CDS 100% 13.200 9.240 N SYCP1 n/a
5 TRCN0000151200 GCAACAAGCTTTCACTAGAAA pLKO.1 1766 CDS 100% 5.625 3.938 N SYCP1 n/a
6 TRCN0000150601 GCAAAGACTAATCTCTCCAAA pLKO.1 358 CDS 100% 4.950 3.465 N SYCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01631 pDONR223 100% 80.1% 79% None (many diffs) n/a
2 ccsbBroad304_01631 pLX_304 0% 80.1% 79% V5 (many diffs) n/a
3 TRCN0000477850 TACATCGAAATTTTCCAAGAGGCC pLX_317 16.5% 80.1% 79% V5 (many diffs) n/a
Download CSV