Transcript: Human XM_011542148.2

PREDICTED: Homo sapiens lin-28 homolog A (LIN28A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIN28A (79727)
Length:
2097
CDS:
115..744

Additional Resources:

NCBI RefSeq record:
XM_011542148.2
NBCI Gene record:
LIN28A (79727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416070 GCACAGAATTGAGCCACAATG pLKO_005 733 CDS 100% 10.800 15.120 N LIN28A n/a
2 TRCN0000021801 GCACCAGAGTAAGCTGCACAT pLKO.1 336 CDS 100% 4.050 5.670 N LIN28A n/a
3 TRCN0000021800 CCTGGTGGAGTATTCTGTATT pLKO.1 448 CDS 100% 13.200 9.240 N LIN28A n/a
4 TRCN0000021802 ACCTACTTTCGAGAGGAAGAA pLKO.1 679 CDS 100% 4.950 3.465 N LIN28A n/a
5 TRCN0000447230 AGAGCATGCAGAAGCGCAGAT pLKO_005 494 CDS 100% 4.050 2.835 N LIN28A n/a
6 TRCN0000021803 TGCTACAACTGTGGAGGTCTA pLKO.1 529 CDS 100% 4.050 2.835 N LIN28A n/a
7 TRCN0000021799 CACCTTTAAGAAGTCAGCCAA pLKO.1 399 CDS 100% 2.640 1.848 N LIN28A n/a
8 TRCN0000102579 CATCTGTAAGTGGTTCAACGT pLKO.1 240 CDS 100% 2.640 1.848 N Lin28a n/a
9 TRCN0000102576 CCAGCCCAAGAAGTGCCACTT pLKO.1 582 CDS 100% 1.350 0.810 N Lin28a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04116 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04116 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474198 ACGACCAATATGTACTAAATTCTT pLX_317 74% 99.8% 33% V5 (not translated due to prior stop codon) 200_201insC n/a
Download CSV