Transcript: Human XM_011542931.2

PREDICTED: Homo sapiens GRAM domain containing 1B (GRAMD1B), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD1B (57476)
Length:
4338
CDS:
1079..3220

Additional Resources:

NCBI RefSeq record:
XM_011542931.2
NBCI Gene record:
GRAMD1B (57476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257476 GAGGACTACTTCCGCCATTTA pLKO_005 2531 CDS 100% 13.200 18.480 N GRAMD1B n/a
2 TRCN0000247556 ACTACTTCTACACAATCAATC pLKO_005 2385 CDS 100% 10.800 7.560 N GRAMD1B n/a
3 TRCN0000257486 AGAGTGAATGTTACGTGATAG pLKO_005 2328 CDS 100% 10.800 7.560 N GRAMD1B n/a
4 TRCN0000257481 TCCCAATGCCATCCAAGTTTG pLKO_005 1462 CDS 100% 10.800 7.560 N GRAMD1B n/a
5 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 4060 3UTR 100% 4.950 2.475 Y NPHS1 n/a
6 TRCN0000136423 CTGCTTCTACAGCAACATCTT pLKO.1 1366 CDS 100% 4.950 2.475 Y GRAMD1A n/a
7 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4099 3UTR 100% 4.050 2.025 Y P3H4 n/a
8 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4099 3UTR 100% 4.050 2.025 Y ORAI2 n/a
9 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4099 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000200720 GCCTCATTGTTGATTACTCTT pLKO.1 1287 CDS 100% 4.950 2.970 N Gramd1b n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4226 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08735 pDONR223 100% 89.1% 88.7% None (many diffs) n/a
2 ccsbBroad304_08735 pLX_304 0% 89.1% 88.7% V5 (many diffs) n/a
3 TRCN0000465695 GACTAAAGGTCGTCCTACCGATTA pLX_317 16.2% 89.1% 88.7% V5 (many diffs) n/a
4 ccsbBroadEn_08736 pDONR223 100% 89% 88.7% None (many diffs) n/a
5 ccsbBroad304_08736 pLX_304 0% 89% 88.7% V5 (many diffs) n/a
6 TRCN0000481176 CCCAACGGCCCCACGATTGATAAG pLX_317 18.1% 89% 88.7% V5 (many diffs) n/a
Download CSV